방법:코끼리를 냉장고에 집어넣는 법

백괴사전, 너희 모두의 백과사전
이동: 둘러보기, 검색
Gorillatrans.gif HowTo 
이 문서는 백괴사전의
방법 시리즈입니다.
더 많은 방법을 찾아보세요
코끼리를 냉장고에 집어넣기란 쉬운 일이 아니다.

“공리 1. 코끼리는 냉장고 안에 들어갈 수 있다.”

코끼리, 힐베르트에게
위키백과의 사람들은 유머 감각이 떨어지기 때문에, 이 항목을 만들 수 없습니다. 위키백과에서 찾거나 만들 생각은 꿈도 꾸지 마십시오! 만약 만들었다간 엘살바도르로 끌려가서 구세주가 되어야 할 것입니다.

코끼리를 냉장고에 집어넣는 법은 말 그대로 코끼리냉장고에 집어넣는 방법을 말한다. 이 문제의 기원에 대해서는 아직까지도 명확히 알려진 바가 없으나, 가장 널리 받아들여지는 설은 고대 그랬어의 저명한 철학자, ‘이기머꼬 다모르게스’가 풀밭에 드러누워 전서구를 훈련시켜 스팸 메일로서 듕귁인들을 공격하는 작전의 실효성을 검토하던 중 ‘하지만 코끼리를 어떻게 냉장고에 집어넣는단 말인가?’라는 의문을 던졌다는 것이다. 이 문제는 기원전 80년경 처음 제시된 이후로 수많은 사람들의 골치를 썩였다.

그리고 78년, 이슬람 역사상 가장 지혜로운 학자로 추앙받는 ‘이스마일 빈 이븐 빈 압델 빈 머리로 모하나 마르차니 알리’가 자신의 학식을 기록한 책 '쓰쓰빠빠 알-쭈빠쭈빠?'에 아래와 같은 해법을 제시하였다.

  1. 냉장고 문을 연다.
  2. 코끼리를 넣는다.
  3. 냉장고 문을 닫는다.

고전적인 방법은 가장 널리 알려져 있고, 미학적으로 가장 뛰어나다고 평가받는다. 그렇지만, 그 누구도 이 방법으로 코끼리를 냉장고에 집어넣는 데 성공하지 못했다. 왜냐햐면, 이 방법이 제일 이해하기 어려우면서, 극악의 난이도를 자랑하기 때문이다.

백괴사전의 설립자인 오스카 와일드의 말에 따르면 오직 이 방법만이 진리이며, 이 방법 외의 방법으로 코끼리를 냉장고에 넣으면 그것은 아주 변태적인 행위이자, 코끼리에게' 너는 변태다!!'라고 말하는 것과 같기 때문에 권장하지 않는다. 무엇보다, 저 상황에서 기린을 넣을 수 있기 때문에 고전적인 방법이 확실히 다른 방법보다 응용도가 좋다.

편법을 사용하면 쉽고 빠르고 간편하게 코끼리를 집어넣을 수 있다. 아래에서는 여러 버전의 편법들을 소개한다. 물론 이를 시도하면 변태라는 소리를 듣게 될 것이다.

참고로 이 문서는 해마다 바이트 수가 두 배 정도로 불어난다는 특징이 있다는데 알게뭐야.

과학적 편법[원본 편집]

공학적 편법[원본 편집]

예술적 편법[원본 편집]


이 방법은 이미 실현되었습니다!

냉장고에 들어갈 수 있을만한 종이에 코끼리 그림을 그린다.
그리고 그 종이에 '코끼리'라고 적는다.
종이를 냉장고에 넣는다.
코끼리를 도축한다.
코끼리 고기를 통조림으로 만든다.
통조림을 냉장고에 넣는다.
코끼리를 암수 한 마리씩 구한다.
코끼리의 수정란을 구한다.
수정란을 냉장고에 넣는다.
유전공학 2
피그미코끼리를 선사 시대 화석에서 복제한다.
그 코끼리를 냉장고에 넣는다.
유전공학 3
Growth Factor Gene을 knock down시킨 코끼리를 만든다.
난쟁이로 자라난 코끼리를 냉장고에 넣는다.
유전공학 4
백터에 코끼리의 유전자를 붙여넣는다.
백터를 E.Coli에 집어넣는다.
E.Coli를 배양시킨 샬레를 냉장고에 넣는다.
코끼리보다 큰 냉장고를 개발한다.
코끼리를 냉장고 안에 넣는다.
기계공학 2
코끼리의 모습을 본딴 로봇을 개발한다.
로봇의 이름을 짓는다.
로봇를 냉장고에 넣는다.
신문에 대서특필 한다. "한국, 로봇코끼리를 냉장고에 넣다!"
왜국이 따라할 수 없게 특허를 낸다.
기계공학 3
문이 코끼리 쪽으로 열린 냉장고들을 빈틈없이 용접해 코끼리를 모든 방면에서 둘러싼다.
이제 코끼리는 커다란 냉장고 속에 들어가 있는 것과 다를 바 없다.
‘코끼리’를 low pass filter에 통과시킨다. 그럼 ‘고기리’가 나온다.
‘고기리’에 circular right shift 연산을 한다. 그럼 ‘리고기’가 된다.
‘리고기’를 증폭비 5인 Non-invert OP-Amp 회로에 통과시킨다 그러면 ‘5·리고기’가 된다.
이제 오리고기를 냉장고에 넣는다.
'코끼리'를 넣을 수 있는 Reefer Ship을 발주한다.
Reefer Ship이 완성되어 선주에게 인도한다.
선주는 Reefer Ship에 '코끼리'를 선적한다.

물리학적 편법[원본 편집]

냉장고 문을 닫는다.
코끼리가 냉장고를 향해 돌진한다.
위 단계를 반복하면 양자 터널링 현상이 발생해 언젠가는 코끼리가 냉장고 안에 들어간다.
일반화해 계산하면, 초당 1회 충돌시 150억년 정도 충돌하면 터널링이 가능하다.
양자역학 2
코끼리와 냉장고를 한 방에 넣는다.
불확정성 원리에 따라 코끼리와 냉장고의 위치는 확실하지 않으므로 코끼리가 냉장고에 들어가 있을 확률이 있다.
양자역학 3
코끼리가 자신을 이루는 입자를 두 개씩 짝짓는다.
스핀이 \frac {1}{2}의 정수배인 페르미온은 한 공간에 둘씩밖에 들어가지 못하지만, 스핀이 정수배인 보존은 한 공간에 무한히 들어갈 수 있다.
즉, 모든 페르미온을 둘씩 짝지어 정수배 스핀으로 만든 뒤 한 장소로 모아 냉장고에 넣으면 된다.
양자역학 4
코끼리가 들어가지 않는 이유는 \Delta x가 크기 때문이다.
따라서 p 공간에서 푸리에 변환하면 \Delta p는 작을 것이다.
p 공간에서의 파속을 넣는다.
슈뢰딩거의 코끼리
코끼리는 외부와 격리된 상자 안에 있다.
그리고 이 상자는 액체질소가 가득 담긴 탱크와 호스로 연결되어 있다.
이 탱크 역시 외부와 격리되어 있으며, 방사능 감지 장치에 의해 호스가 열린다.
만약 호스가 열린다면, 상자 안으로 액체질소가 유입되어 코끼리가 얼어버린다.
그리고 이 호스를 열게 하는 방사능 검지 장치 옆에는 라듐을 핵분열시켜 알파선을 만들어내는 장치가 있다.
자, 이제 핵분열이 시작된다. 핵이 분열될 확률은 반반이다.
그러므로, 반의 확률에서는 관찰자가 “분열되지 않은 핵과 얼지 않은 코끼리”를,
반의 확률에서는 “분열된 핵과 언 코끼리”를 관찰할 수 있다.
그러니까 반의 확률에서는 코끼리가 언 것이다. 상자 안에서 얼었다면 상자가 냉장고인거지.
냉장고가 우주 밖에 있다.
우주를 구성하는 입자를 분석하여 차원을 비교한다. 초끈이론에 의하여 공간을 의미하는 입자는 11차원이다.
아주 작게 뭉쳐진 7개의 입자 중 4개의 입자를 크게 펼쳐 크게 펼쳐져 있던 차원을 작게 오그라뜨린다. 그 결과 우주가 수축한다.
이제 우주를 냉장고 안에 넣는다. 코끼리도 같이 들어가게 된다.
평행 우주
약력 막에 코끼리를 놔둔다.
중력 막에 냉장고를 놔둔다.
코끼리를 약력 막에서 중력 막으로 이동시키면 크기가 작아진다.
크기가 작아진 코끼리를 냉장고 안에 넣는다.
코끼리를 냉장고를 향해 걷게 한다.
코끼리의 궤도가 냉장고를 지남을 보인다.
코끼리의 파동을 계산한다.
코끼리와 상쇄 간섭하는 파동을 발생시킨다.
코끼리의 파동과 반-코끼리의 파동이 냉장고에 들어간 후 서로 소멸한다.
결맞는 빛을 강렬하게 발생시켜 건판에 쬐고, 동시에 코끼리에서 반사된 빛도 쬔다.
이 때 형성된 간섭무늬는 코끼리의 모든 광학적 정보를 담고 있다.
건판을 넣는다. 건판이 너무 크면 잘라서 넣어도 홀로그램 정보가 보존된다.
코끼리를 기화시킨다.
코끼리의 상변화가 일어나지 않게 온도를 급격히 낮춰 절대 영도에 수렴하도록 한다.
기체 코끼리의 부피는 이 때 0에 근접하므로 기체 코끼리를 냉장고에 넣는다.
코끼리의 엔트로피를 낮춘다.
그러면 접근 가능한 코끼리 구성입자의 상태수가 줄어든다.
엔트로피를 충분히 낮춰 냉장고보다 작은 공간에 코끼리를 구성하는 입자가 몰려있는 접근가능상태를 고른다.
그 코끼리를 냉장고에 넣으면 된다.
통계역학 2
언젠가 코끼리를 이루는 모든 입자가 냉장고에 들어가 있을 것이다. 그 확률은 0보다 크므로.
상대성 이론
코끼리의 2차원 시면적보다 큰 냉장고를 만든다.
코끼리를 광속에 가깝게 가속시킨다.
로렌츠 수축이 일어나 코끼리의 길이가 운동 방향으로 축소되므로 코끼리는 냉장고 안에 들어갈 수 있다.
그러나 코끼리 입장에서는 냉장고가 로렌츠 수축이 일어나는 걸로 보인다.
그러니 알 게 뭐야.

화학적 편법[원본 편집]

일반 화학
수많은 냉장고를 중합시킨다.
이제 중합된 냉장고들의 용량은 코끼리를 수용하고도 남는다.
무기 화학
코끼리를 녹일 수 있는 액체에 코끼리를 녹인 뒤 액체를 냉장고에 넣는다.
그 액체를 증발시키면 코끼리가 다시 석출된다.
코끼리를 불에 태워 코끼리의 잿가루를 얻는다.
그 잿가루를 냉장고에 넣는다.

생물학적 편법[원본 편집]

고래가 코끼리와 냉장고를 동시에 삼킨다.
유기체인 코끼리는 냉장고보다 빨리 분해되므로 코끼리의 잔해가 냉장고에 들어가 있을 가능성이 있다.
코끼리과의 하위 분류로 '냉장고속'을 새로 만든다.
어떤 코끼리종은 냉장고속에 포함된다고 정의를 바꾼다.
냉장고속에는 코끼리가 들어가 있다.
지구온난화로 기온이 급격히 상승하였다.
코끼리는 더위를 피할 곳이 필요하고 냉장고는 자신의 온도를 유지시킬 것이 필요하다.
냉장고와 코끼리가 공생한다면 위 욕구는 충족될 것이다.
따라서 냉장고 안에 코끼리가 들어가는 방향으로 진화가 일어난다.
코끼리의 체세포에서 DNA를 추출해 코끼리의 DNA를 냉장고에 넣는다.
저명한 교과서에 코끼리는 냉장고에 들어간다는 사실을 명시한 후 학생들에게 외우도록 한다.
코끼리가 냉장고 속에서 변사체로 발견되었다.
부검해보니 별 다른 외상이나 내부 파열은 보이지 않는다.
이 코끼리의 사인은 냉장고 출입으로 인한 동사이다.
의 뱃속에 기생충을 키운다
그 기생충의 이름을 코끼리라고 명명한다
코끼리를 냉장고에 넣는다.
코끼리를 자른다.
잘라낸 코끼리를 냉장고에 넣는다.

지구과학적 편법[원본 편집]

CW-7을 뿌린다.
매머드를 코끼리라고 우긴다.
그 매머드는 지구라는 냉장고 안에 있었다.
코끼리를 얼린다.
그 얼음을 깨뜨린다.
얼음조각을 냉장고에 넣는다.
기본 온도가 적당히 낮아 냉장고 역할을 할 수 있는 동굴을 골라 코끼리를 들여보낸 다음 '천연의 냉장고'에 코끼리를 집어넣었다고 주장한다.
냉장고 안에 중성자별을 놓는다.
코끼리가 중성자별로 끌려간다.
천문학 2
코끼리를 계속 먹인다.
코끼리의 질량이 계속 늘어난다.
질량이 늘어나 코끼리 구성 원자가 degenerate state가 될 정도가 되면 코끼리는 중력붕괴를 일으킨다.
이제 부피가 엄청나게 줄어든 ‘중성자 코끼리’ 혹은 부피 0의 ‘블랙 코끼리’를 냉장고에 넣는다.
천문학 3
새로운 은하를 최초로 발견한다.
발견자의 권리에 따라 'Fridge001'이라고 명명한다.
그 은하 안에서 천체를 찾는다.
발견자의 권리에 따라 'Elephant'이라고 명명한다.
이제 냉장고 안에 코끼리가 있다.
천문학 4
새로운 블랙홀을 최초로 발견한다.
발견자의 권리에 따라 'fridge x1'이라고 명명한다.
우주선에 코끼리를 태워서 우주선을 블랙홀로 빨려들어가게 만든다.
이제 냉장고 속에 코끼리가 있다.
빅 크런치를 일으킨다.
코끼리와 냉장고가 한 점에 압축되었으므로 코끼리는 냉장고 내부에 있다.
우주론 2
빅 프리즈를 일으킨다.
우주 자체가 냉장고가 되었으므로 코끼리도 냉장고 내부에 있다.

정보과학적 편법[원본 편집]

알파고한테 시킨다.
코끼리 클래스를 만든다
냉장고 클래스를 만든다. 이 때, 코끼리 클래스를 private 상속받는다.
그러면 냉장고와 코끼리는 has-a 관계가 되어, 냉장고는 코끼리를 내부에 갖는다.
친구?가 아니면 심지어 꺼낼 수도 없다.
문자열 변수를 만든다 이때 변수이름은 "냉장고" 또는 "Refrigerator"으로 한다
이 변수에 "코끼리" 또는 "Elephant"를 값으로 준다
ICPC(국제 프로그래밍 경연 대회)
ICPC A번 문제로 낸다.
듕귁 애들이 푼다.
Flash 5,MX,MX 2004,8,CS3,CS4,CS5
이 방법은 이미 실현되었습니다!
Elephant in a refrigerator.png
'냉장고' 무비클립에 '코끼리' 무비클립을 삽입한다.
Copy & Paste
코끼리를 클릭한다.
냉장고를 클릭한다.
워드 프로세서
냉장고 문서에 코끼리라는 글귀를 써 넣는다.
이 방법은 이미 실현되었습니다!
냉장고 클립아트 위에 코끼리 클립아트를 붙인다


스프레드시트 프로그램
셀로 냉장고 모양(만들기 힘들 걸? 그냥 위 같이 하...)을 만들고 그 안에 코끼리라는 글자를 써 넣는다.
이 방법은 이미 실현되었습니다!
‘바탕화면 보기’ 버튼을 누른다.
바탕화면에서 마우스 오른쪽 버튼을 누른다.
새로만들기→새 텍스트 문서 를 클릭한다.
이름을 코끼리.txt로 바꾼다.
더블클릭하여 메모장에서 연다.
'코끼리'라는 글귀를 입력한 후, Ctrl+s를 누른다.
바탕화면에서 마우스 오른쪽 버튼을 누른 후, 새로만들기→새 폴더 를 클릭한다.
이름을 ‘냉장고’로 입력한다.
코끼리.txt를 드래그해 냉장고 폴더에 드랍한다.
이 방법은 매우 난이도가 높으므로 전 세계에 이 작업을 완벽히 해결할 수 있는 사람은 빌 게이밖에 없다 카더라.
특히, 마지막 단계는 빌 게이도 성공확률이 절반 미만이라 카더라.
이 방법은 이미 실현되었습니다!
'냉장고'라는 이름의 파일을 불러온다.
추가한 레이어의 이름을 '코끼리'로 정한다.
OS(Window) 2
이 방법은 이미 실현되었습니다!
바탕화면에서 마우스 오른쪽 버튼을 누른다.
새로 만들기→ 폴더를 누른다.
폴더 이름을 냉장고로 바꾼다.
또 바탕화면에서 마우스 오른쪽 버튼을 누른다.
새로 만들기→ 폴더를 누른다.
폴더 이름을 코끼리로 바꾼다.
폴더 '코끼리' 에 마우스 오른쪽 버튼을 누른다.
잘라 내기를 누른다.
'냉장고' 폴더에 붙여넣기를 한다.
그러면 냉장고 안에 코끼리가 들어간다.
그런데 가끔씩 코끼리 폴더 안에 동물 이름 폴더가 있다 카더라.
gedit을 연다. (없으면 sudo yum install gedit 혹은 sudo apt-get install gedit 하라 카더라)
'코끼리'라고 입력한 뒤 저장을 한다.
이름란에 '냉장고'라고 적는다. (.txt같은 찌질한 파일 형식은 쓸 필요 없다 카더라)
이 방법은 리누스도 실패한다 카더라.
[[email protected] ~]$ mkdir experiment
[[email protected] ~]$ cd experiment/
[[email protected] experiment]$ touch elephant
[[email protected] experiment]$ mkdir refrigerator
[[email protected] experiment]$ mv elephant refrigerator/
[[email protected] experiment]$ ls -Al refrigerator/
합계 0
-rw-rw-r-- 1 devdragon devdragon 0 2010-09-18 23:53 elephant
[[email protected] experiment]$
코끼리는 냉장고에 들어갔다!
객체지향 (1)
‘코끼리’를 냉장고에 집어넣어야 하는 문제를 인식한다.
문제를 객체에게 시킨다. 여기서 객체는 조교 혹은 연구원등이 사용될 수도 있다.
뽀#으로 합성한다.
Game Maker
‘room_refrigerator’ 룸을 생성한 후 ‘obj_elephant’ 오브젝트를 룸 안에 추가시킨다.
Game Maker 2
라이브러리를 하나 만들고 그 안에 하나의 액션을 만들어 'Elephant'라고 이름붙인다.
오브젝트를 하나 만들어 'obj_refeigerator'로 이름을 바꾸고 라이브러리를 적용시켜 액션을 'Create Event'에 넣는다.
코끼리가 냉장고에 들어갔다!
Scratch 2 1
프로젝트를 하나 만들고 'Fridge'라고 이름붙인다.
스프라이트를 하나 만들어 코끼리 사진을 가져와 적용한 다음 'Elephant'라고 이름붙인다.
Scratch 2 2
프로젝트를 하나 만들고 '방법:코끼리를 냉장고에 집어넣는 법'이라고 이름붙인다.
무대에 냉장고 사진을 적용한 다음 'Fridge'라고 이름붙인다.
코끼리 사진을 적용한 스프라이트를 'Elephant'라고 이름붙인다.
이 방법은 이미 실현되었습니다!
틀:냉장고 문서로 간다.
냉장고 안에 {{{1}}} 있다. 를 추가한다.
이제 아무 문서로 가서 {{냉장고|코끼리}}를 추가하고. 저장 버튼을 누른다.
즉, 이렇게: 냉장고 안에 코끼리 있다.
위키 2
이 방법은 이미 실현되었습니다!
코끼리 문서로 간다.
[[분류:냉장고]]를 추가한다.
위키 3
냉장고 문서로 간다.
Import 권한을 사용해서 아무 위키 내부의 코끼리 문서의 역사를 냉장고 문서에 합쳐버린다.
여기 참고.
이 방법은 이미 실현되었습니다!
"코끼리"라는 글을 쓴 후 냉장고라는 글을 써서 코끼리라 쓴 글을 핑백시킨다.


〈코끼리를 냉장고에 집어넣는 법에 관하여: 문헌정보학적 고찰을 중심으로〉(ISBN i)를 저술한다.
누군가 그 방법을 실행한다.
혹은, 코끼리를 직접 집어넣을 경우, 이용자가 이용하는데 많은 불편이 따르므로 코끼리에게서 특징들을 뽑아내 대용물인 목록을 만들어 이용자가 이용할 수 있게 한다.

전산 언어를 쓴 편법[원본 편집]

#include <Array.au3>
Global $FRIDGE[1] = ["elephant"]
_ArrayDisplay($FRIDGE, "냉장고 내부")
10 set x=r($)=input$(n)
20 set elephant=x
30 set fridge=x+r(x)
40 if elephant<fridge then 50 else 60
50 end
60 print "Error!"
70 cls
80 goto 10
단, 경우에 따라 신택스 에러가 날 수도 있으니 알 게 뭐야.
<div class="FRIDGE">코끼리</div>
$(document).ready(function (){
<o:냉장고 xmlns:o="http://uncyclopedia.kr/xml/o"><o:코끼리 /></o:냉장고>
<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE plist PUBLIC "-//Apple//DTD PLIST 1.0//EN" "http://www.apple.com/DTDs/PropertyList-1.0.dtd">
<plist version="1.0">
List<Object> refrigerator = new LinkedList<Object>();
refrigerator.add(new Elephant());
#import <UIKit/UIKit.h>
@interface refrigerantAppDelegate : NSObject <UIApplicationDelegate>
    refrigerant *r;
    elephant *e;
@property (nonatomic, retain) IBOutlet refrigerant *r;
@property (nonatomic, retain) IBOutlet elephant *e;
@implementation refrigerantAppDelegate
@synthesize r, e;
(void)applicationDidFinishLaunching:(UIApplication *)application 
    [r addSubview:e.view];
    [r makeKeyAndVisible];
    [r release];
    [e release];
    [super release];
// 주의: 파일명을 Fridge.c로 정해야 함.
#include <Elephant.h>
// 끝.

참 쉽죠잉??

class Elephant{}
class Fridge{
    Elephant e;

class Elephant{};
class Fridge : private Elephant{
C++ 2
#include "living.h"
#include "electronic.h"
using namespace peoples_fixed;
class Elephant : public LivingOrganism
  private :
    Leg l[4];
    Tail t;
    Nose n;
  public :
    void shakeNose(){ n.shake() }; 
class Fridge : public Electronic
  private :
    Room r[2];
    Refrigerant re=0;
  public :
    void getIn(void *s){ if(sizeof(r[0]) > sizeof(s)) r[0]=s; else r[1]=s;}
    void *getOut(void *s){ if(r[0]==&s){r[0]=NULL; return s;} else if(r[1]==&s){r[1]=NULL; return s;} else return NULL;}
    void startOperate(){re=1;}
    void stopOperate(){re=0;}
void main()
  Elephant a;
  Fridge b;
  b.getIn(a); b.startOperate();
컴파일 될 지 안될지는 알 게 뭐야.
fridge = []
print fridge
procedure TForm1.Button1Click(Sender: TObject);
  TFridge = class(TElectronics);
  TElephant = class(TAnimal);
  Fridge : TFRIDGE;
  Eleelephant : TElephant;
  Fridge := TFridge.Create;
  Elephant := TElephant.Create;
mIRC 스크립트
on 1:input:#: { 
if ($1 == !넣어) { 
  set %fridge.inside $null
  set %kokkiri 코끼리
  set %fridge.inside %코끼리
  msg $chan 현재 냉장고 속 : %fridge.inside 이 안에 있습니다
echo 코끼리 > 냉장고
SET 냉장고=코끼리
REM 이제 냉장고 속에 코끼리가 들어갔다!
sudo apt-get install elefridge
elephant-into-refrigerator --initial
shutdown -r now

페도라기타 레드햇 계열은 다음과 같이 하면 된다 카더라.

su -
yum install elefridge
elephant-into-refrigerator --initial
shutdown -r now

$fridge = ("elephant");
INSERT INTO [냉장고] ( [내용물] ) VALUES ( N'코끼리' )
Objective Caml
let push e = match e with
|  코끼리 -> e
|  _ -> [[알 게 뭐야]]
in 냉장고;;
ActionScript 2/3.0
var fridge:Array = new Array();
trace("fridge : "+String(fridge));
ActionScript 3.0
new Fridge().addChild(new Elephant());

Game Maker
<Create Event>

의사과학적 편법[원본 편집]

연금술으로 코끼리모양 금조각을 만든다.
금조각을 냉장고에 넣는다.
에게 코끼리가 냉장고에 들어갈 수 있는지 묻는다.
이쁜 사진을 찍는다.
물은 답을 알고 있다고 한다.
창조과학 1
진화론이 코끼리가 냉장고에 들어가는 것을 설명하는지 찾는다.
그런 논문이 없다! 진화론은 무조건 틀렸으므로 코끼리는 냉장고에 들어간다.
창조과학 2
화석을 냉장고에 넣는다.
또 다른 화석을 넣는다. 그 사이에 미싱링크가 있다고 주장한다.
화석을 또 넣으면 3개의 화석 사이에 두 개의 미싱링크가 있다고 주장한다.
이것을 반복하여 미싱링크 숫자를 코끼리가 들어갈만큼 만든다.
코끼리를 그 사이에 넣는다.
창조과학 3
분류학상 냉장고 속(屬)의 냉장고 종(種)의 위치를 표기한다.
분류학상 냉장고 속 냉지앙고 종의 위치를 표기한다.
이 두 종간 도약은 너무 멀어 불가능하다고 우긴다. 그 거리는 코끼리보다 크다.
그 사이에 코끼리를 넣는다.
코끼리가 냉장고에 들어가기엔 너무 복잡하다
지적인 설계자에 의해 냉장고에 들어가는 코끼리가 탄생했다.
우리는 창조론과 다르다.
냉장고에 코끼리가 들어갈 수 있다고 펜실베니아주 도버로가서 재판을 연다.
안테나가 달린 곳으로 수송선이 내려온다.
안테나를 냉장고 안에 넣는다.
안테나에다 대고 수송선이 코끼리를 싣고오기를 빈다.
가까운 미래에 목성토성이 일렬로 늘어서서 물병자리와 물뱀자리 사이에서 운행한다.
이때 신묘한 일이 일어나는데 그것은 코끼리가 냉장고 안에 들어가는 것이리라.
코끼리의 신체리듬과 감성리듬, 지성리듬을 조사한다.
이 세 가지 리듬이 모두 고조기일 때를 노린다.
그 때가 왔으면 그 코끼리를 냉장고에 넣을 사람들의 바이오리듬을 조사한다.
그 사람들 중 신체, 감성, 지성리듬이 모두 고조기인 사람을 골라서 코끼리를 집어넣도록 시킨다.
만물은 물, 불, 흙, 공기 네 가지로 이루어져 있다.
코끼리도 물, 불, 흙, 공기 네 가지로 이루어져 있다.
물, 불, 흙, 공기를 냉장고에 넣는다.

그 외의 의사학문적 편법[원본 편집]

뭐니뭐니해도 한민족이 이 지구상에서 가장 킹왕짱임.
고로 코끼리를 냉장고에 넣는 일 따윈 아무 것도 아님. 오케이?

수학적인 편법[원본 편집]

해석적 편법[원본 편집]

미분과 적분
코끼리를 미분한다.
냉장고에서 적분한다.
적분상수는 알아서 구한다.
코끼리가 상수면 알 게 뭐야
냉장고를 복소 평면의 원점에 둔다.
코끼리가 냉장고 밖에 있을 때, \frac {1}{z}로 보낸 상을 구한다.
복소해석 2
코끼리를 단순 연결인 복소평면 위에 놓는다.
코끼리를 적당한 닫힌 곡선을 골라 선적분하면 코시의 적분정리에 따라 적분값이 0이 된다.
그 0을 냉장고에 넣는다.
극한 1
양수 x에 대해 코끼리의 크기함수를 E(\frac {1}{x})라 하고 냉장고의 부피함수를 R(x)라 한다. 단, 두 함수는 연속이다.
 \lim_{x \to \infty} !
이제 크기가 0에 수렴하는 코끼리를 부피가 양의 무한대로 발산하는 냉장고에 넣는다.
극한 2
냉장고 문을 열고 코끼리와 냉장고 내벽 사이의 거리를 x라고 놓는다.
\lim_{x \to 0}
코끼리는 냉장고 내벽과 거의 붙어 있다
냉장고 문을 닫는다
코끼리가 해석적임을 보인다.
코끼리의 테일러 급수를 구한다.
급수의 각 항들을 예쁘게 정리해서 냉장고에 넣는다.
실해석 2
코끼리의 작은 부분을 나타내는 수열을 a_n이라 하자.
\sum_{k=1}^{\infty}a_k는 코끼리가 될 것이다.
a_n의 각 항의 순서를 교묘하게 바꿔서 a_n의 무한급수가 냉장고에 들어갈 만큼의 부피로 수렴하게 만든다.
이제 변형된 코끼리를 냉장고에 넣는다.
코끼리의 코를 제외한 나머지의 측도를 영측도로 만든다.
코를 냉장고에 집어넣는다.

기하학적 편법[원본 편집]

원과 직선으로만 이루어진 코끼리와 냉장고를 생각한다.
원과 직선은 작도가능하므로 냉장고와 코끼리를 작도할 수 있다.
이 때, 인식 가능한 크기의 코끼리를 작도한 후 코끼리가 냉장고의 내부에 있도록 냉장고를 작도한다.
고차원 기하학
공간을 4차원으로 확장한다.
냉장고의 2차원 막 표면은 4차원 공간을 내부와 외부로 가르지 못함을 보인다.
코끼리에게 냉장고를 먹인다.
코끼리의 안과 밖을 뒤집는다.
위상수학 2
냉장고를 클라인 병으로 만든다.
위상수학 3
코끼리와 닭이 위상동형임을 보인다.
코끼리를 닭으로 변형한다.
닭을 냉장고에 넣는다.
위상수학 4
냉장고를 코끼리 위에 둔다.
위상학적으로 둘의 위치는 구별할 수 없다!

수학기초론적 편법[원본 편집]

공리계를 다음과 같이 설계한다:
"공리 1. 코끼리는 냉장고 안에 들어갈 수 있다."
논리학 2
코끼리를 이루는 원자 1개가 냉장고에 들어감을 증명한다.
모든 자연수 k에 대해, 코끼리를 이루는 원자 k개가 냉장고에 들어감과 (k+1)개가 냉장고에 들어감이 동치임을 증명한다.
수학적 귀납법에 따라 코끼리를 이루는 모든 원자는 냉장고에 들어간다.
논리학 3
코끼리는 동물이다.
동물은 냉장고에 넣을 수 있다.
그러므로 코끼리는 냉장고에 넣을 수 있다.
논리학 4
산술을 기반으로 한 공리계 A에서 ‘모든 코끼리는 냉장고에 들어갈 수 있다.’라는 명제를 증명하려고 시도한다.
괴델에게 갈아만든 백괴사전을 먹인다.
위 명제의 증명 불가능성을 증명한다.
이제 위 명제의 진리치는 부정이다. 즉 참이거나 거짓이다.
위 명제를 참이라고 생각해도 공리계 A에 영향을 주지 않으므로 공리로 받아들이면 코끼리는 냉장고에 들어갈 수 있다고 말할 수 있다.
"코끼리를 냉장고 속에 집어넣을 수 없다"라고 가정한다.
가정하면 가정이 화목하다
화목이 아니라 월수금이다. 모순
코끼리 ∈ 냉장고 임을 보인다.
집합론 2
코끼리를 냉장고로 보내는 사상 f:{코끼리}→{냉장고}를 생성한다.
집합론 3
코끼리와 닭을 무한집합으로 둔다.
#코끼리 = #닭 임을 보인다.
닭을 냉장고에 넣고 코끼리에서 닭으로 함수를 쏜다.

대수적 편법[원본 편집]

코끼리 몸의 부분 부분이 냉장고에 들어감을 보인다.
냉장고가 덧셈에 대해 닫혀 있음을 보인다.
코끼리를 닭으로 치환한다.
닭을 냉장고에 넣는다.
고전대수 2
코끼리의 존재를 X라 정의하고
냉장고의 존재를 Y라 정의한다.(XY는 양수이고 Y<X이다.)
Y = X+a (a는 공간)
Y-X = a
고전대수 3
여러분,  \frac{a + b^n}{n} = x 입니다. 따라서 코끼리는 냉장고에 들어갑니다. 이의 있습니까?
- 오일러
냉장고에 들어 있는 코끼리는 0마리다.
그런데 1 = 0이므로 냉장고 안에 들어 있는 코끼리는 1마리이다.
따라서 원래부터 냉장고 속엔 코끼리가 1마리 들어 있었다.
코끼리의 기저(basis)만 구해서 냉장고에서 생성(span)한다.
선형대수 2
코끼리를 행렬로 선형적으로 바꾼 행렬(A)의 기저를 파악해서 불필요한 벡터를 없앤다.
이것을 냉장고를 선형적으로 바꾼 행렬(B)에 포함하게 하여, 코끼리의 차원 →냉장고의 차원으로 바꾼다.
단, 가끔 가다 불필요한 벡터가 코끼리의 코나 귀나 다리, 또는 덕후들이 달려드는 부분일 수 있으나 알 게 뭐야.
선형대수 3
코끼리가 있는 좌표를 냉장고의 내부에 있는 점으로 보내는 선형변환을 실시한다.

정수론적 편법[원본 편집]

는 코끼리를 냉장고에 집어넣는 놀라운 방법을 알고 있다.
그러나 여백이 부족하므로 적지 않겠다.
해석적 정수론
는 드디어 코끼리를 냉장고에 집어넣는 놀라운 방법을 발견하여 종이에 적는다.
그러나 네가 집을 비운 사이에 하인이 태워버린다.
코끼리를 소인수분해한다.
소인수와 지수를 집어넣는다.
코끼리가 소수라면 적당한 수를 빼서 합성수로 만든뒤 위를 반복한다.
소수 2
코끼리를 소인수분해하면 ㅋ*ㅗ*ㄲ*ㅣ*ㄹ*ㅣ이다.
ㅋ은 ㅡ*ㅣ*ㅡ이고, ㅗ는 ㅣ*ㅡ이고,ㄲ은 ㅡ*ㅣ*ㅣ이고,ㄹ은 ㅡ*ㅣ*ㅡ*ㅣ*ㅡ이다.
고로 코끼리=ㅡ^7*ㅣ^8이고, ㅡ는 결국 ㅣ와 같은 모양이므로
결국 ㅣ^15가 되며, 이는 1^15와 같다. 1이 된 코끼리를 냉장고에 집어넣는다.
냉장고를 법이 n인 잉여환으로 둔다.
코끼리와 닭이 법 n에 대해 합동임을 보인다.
닭을 냉장고에 넣는다.

응용수학적 편법[원본 편집]

이 항목은 나무위키의 암묵의 룰 에 따라 나무위키의 스파이가 작성하였습니다(...)
{xlx는 코끼리들의 집합}⊂{xlx는 냉장고의 집합}
증명 부분은 없지만 알 게 뭐야
코끼리 꼬리를 표본으로 추출하고 냉장고에 넣는다.
코끼리를 냉장고에 들어갈 수 있는 확률이 0이 아님을 보인다.
코끼리를 냉장고에 밀어 넣는 시행을 들어갈 때까지 무한 반복한다.
코만 집어넣고 나머지는 오차로 처리한다.
수학의 정석
[정석]코끼리는 냉장고 안에 들어갈 수 있음이 알려져 있다.
자세한 증명은 고교 과정을 넘어서므로 생략하도록 한다.
수학의 정석 2
이 증명은 각 교과서마다 나와 있으니 교과서를 참조하시오.
수학의 정석 3
모르면 뒷장을 펼쳐 본다.
분모를 냉장고, 분자를 코끼리라고 하자.
만약 코끼리를 냉장고로 나누어 1 미만의 수가 나왔다면 코끼리는 냉장고보다 작다.
코끼리는 냉장고보다 작다. 즉, 코끼리 < 냉장고 이므로 부피가 달라져도 결국 코끼리는 냉장고보다 작으므로 코끼리는 냉장고에 들어가게 된다.
만약 코끼리를 냉장고로 나누어 1 이상의 수가 나왔다면 코끼리는 냉장고 보다 크다. 하지만 알 게 뭐야.

이산수학적 편법[원본 편집]

코끼리가 냉장고의 숫자보다 많은 것을 보인다.
비둘기를 코끼리로, 집을 냉장고로 치환한다.
비둘기집 원리에 따라 코끼리가 두 마리 이상 들어간 냉장고가 최소한 하나 있다.
조합론 2
코끼리의 원소를 조합한다.
중복이거나 배열만 다른 원소들은 하나로 줄어든다.
압축된 코끼리를 냉장고에 넣는다.
그래프 이론
냉장고 밖에 있는 코끼리와 냉장고 내부에 있는 점 P를 잇는 그래프를 만든다.
위 그래프는 이상적인 코끼리가 냉장고 안으로 들어가 P와 이어진 그래프와 같다.
코끼리의 첫째항을 구한다.
코끼리의 점화식을 구해 첫째항과 함께 냉장고에 넣는다.

기타 편법[원본 편집]

페르마의 마지막 정리
나는 코끼리를 냉장고 안에 넣는 매우 획기적인 방법을 알고 있으나 이 문서의 용량이 부족해 적지 못한다.

사회과학적인 편법[원본 편집]

차암 쉽쬬잉?
커다란 온장고를 만든다.
가 안에 들어간다.
네가 보기에는 코끼리를 포함한 온 세상이 냉장고 안에 있는 것 같다.
대중심리학 2
코끼리에게 “너는 냉장고에 들어갈 수 있다.”고 최면을 건다.
정말로 코끼리가 냉장고에 들어간다.
갓 태어난 어린 코끼리를 냉장고에 넣고, 이 코끼리가 성장하여 어느 정도의 발달단계에 이를 때까지 냉장고 안에 있을 수 있는지를 본다.
확인 결과 기존의 step-by-step 형태의 발달이론이 틀렸다는 논문을 쓰면서, 그 근거로 코끼리가 냉장고 안에 있음을 입증해 보인다.
코끼리의 일부 살점을 떼어다가 표본으로 삼아서 이것이 냉장고 속에 들어갈 수 있는지를 실험한다.
95% (p<.05) 유의수준에서 코끼리가 냉장고에 들어갈 수 있음을 입증한다. 곧 실험실에서 진행한 연구는 못 믿겠다는 반발이 쏟아질 거고, 재현성도 아마 검증되는 데는 실패하겠지만 신경쓰지 않는다.
춥고 어두운 냉동창고 안에서 활성화되는 코끼리 뇌 영역을 확인하고, 평시 코끼리 뇌 영역의 활성화도 확인한다.
확인 결과 활성화되는 영역에 크게 차이가 없다. 이를 근거로 코끼리는 항상 냉장고 안에 있는 셈이라고 우긴다.
신경심리학 2
코끼리가 냉장고 안에 들어갈 수 있다는 내용의 논문을 대충 휘갈겨 쓴다.
본문과는 아무 상관이 없지만 어쨌거나 뇌 해부도와 fMRI 이미지를 적당히 구글링해서 덕지덕지 첨부해 붙이고, 저 무슨 배외측 전전두피질이니 중뇌수도주변 회백질이니 편도체 피질내측핵이니 하는 전문용어들을 읊조린다. 사람들은 코끼리가 냉장고에 들어갈 수 있다고 믿게 될 것이다.
코끼리가 종이 울릴 때마다 좁디좁은 상자 같은 곳에 파고들어가도록 어릴 때부터 체계적으로 학습을 시킨다.
다 성장한 코끼리의 곁에 냉장고를 두고, 종을 울린다. 이제 코끼리는 냉장고에 들어갈 것이다.
학습심리학 2
처음에는 코끼리가 냉장고를 볼 때 사료를 주고, 다음엔 냉장고로 다가갈 때 주고, 다음엔 냉장고 곁에 머무를 때, 냉장고 문을 열 때, 냉장고에 머리를 들이밀어 볼 때 계속해서 사료를 주면서 학습을 조성한다.
어느 순간 이 코끼리는 알아서 냉장고로 들어가게 될 것이다. 사료를 주면서 엄지를 세워보자. "잘 했어!"
최고높이 2,538mm 이하의 코끼리를 구한다.
40feet High Cube Reefer Containter를 구한다.(더 작은 코끼리라면 20feet, 40feet도 가능)
Container안에 코끼리를 집어넣고 원하는 온도를 설정하여 Monitoring한다.
Reefer Container는 냉장고이므로 코끼리가 냉장고로 들어갔다.
코끼리가 냉장고에 들어가는 꿈을 꾼다.
정신분석학 2
냉장고에 들어가서 코끼리 꿈을 꾼다.
꿈을 꾸는 내가 냉장고 속에 있으므로 꿈속의 코끼리도 냉장고 속에 있다.
정신분석학 3
코끼리가 나비 꿈을 꾼다.
코끼리 가로되, “코끼리가 꿈에 나비가 되었는 지, 또는 나비가 꿈에 코끼리가 되었는 지 알 수 없다.
이제 인생 무상을 깨친 나비가 냉장고에 들어가 코끼리 꿈을 꾼다.
닭을 고문하여 코끼리라는 자백을 받고 넣는다.
경찰행정학 2
로봇 냉장고를 고문하여 코끼리가 들어온 적이 있다는 자백을 받고 이를 기정사실화한다.
코끼리의 거주지역을 냉장고라고 부르게 하는 법률을 제정한다.
법학 2
코끼리를 금치산자로 설정한다.
코끼리의 법정대리인을 닭으로 설정한다.
이제 닭을 냉장고에 넣는다. 그러면 법적으로 코끼리는 냉장고에 들어가 있다.
법학 3
법원에 닭의 이름을 코끼리라고 개명하는 신청을 한다.
법원에서 신청을 인용하면 닭의 이름이 코끼리가 된다.
이제 코끼리가 된 닭을 냉장고에 집어 넣는다.
법학 4
코끼리를 냉장고에 넣는 도급 계약을 맺는다.
계약을 이행하지 않으면 법원에 소를 제기하여 승소 판결을 받아낸다.
승소 판결을 권원으로 하여 강제집행에 들어간다.
강제 집행에 의해 집행관이 코끼리를 냉장고에 넣을 것이다.
‘코끼리를냉장고에집어넣는법’을 행정입법을 통해 국회에서 법이 만들어지도록 한다.
법이 국회에서 통과되면 시행령을 만들고 정책을 집행한다.
코끼리를 냉장고에 넣는다.
만약, 코끼리의 반발이 있을 시 정부 정책의 Public Relation의 한 기능인 홍보를 통해 정책의 필요성과 효과성을 코끼리에게 알려준다.
행정학 2
효과적인 행정 서비스 대응을 위해 테스크포스를 만들고, 이름을 냉장고로 한다.
테스크포스 책임자는 3급, 외부 전문가를 영입하는 것으로 한다.
코끼리를 테스크포스 책임자로 영입한다. 이제 코끼리는 테스크포스 냉장고 안에 있다.
어딘가에 읍이 새로 생기는데, 그곳을 냉장고읍이라고 이름을 붙인다.
냉장고읍 중 한 마을의 이름을 코끼리라고 정한다.(코끼'리')
이제 냉장고에 코끼리가 들어가 있다.
뇌물을 주고 “코끼리는 냉장고에 들어간다.”고 여론을 조작한다.
정치학 2
코끼리가 냉장고에 들어갈 수 없다고 주장한 사람을 허위사실을 유포했다며 고소한다.
판사를 매수하거나 협박한다.
승소 판결을 기다린다.
정치학 3
냉장고에 코끼리의 머리가 들어갈 정도의 구멍을 뚫는다
그 구멍으로 코끼리의 머리를 집어 넣는다.
코끼리의 25.7%가 냉장고에 들어갔으니 사실상 전부 들어간 것과 다름 없다고 주장한다.
괴벨스를 고용한다.
매체를 통해 “코끼리는 닭이다!!”라는 내용의 프로그램을 끊임없이 방송한다.
이제 닭을 냉장고에 넣는다.
언론학 2
코끼리도 들어가지 않는 냉장고는 뒤떨어진 제품이라는 캠페인을 벌인다.
코끼리가 들어가야 제대로 된 냉장고라는 인식이 고조된다.
코끼리가 들어갈 수 있는 냉장고가 속속 등장한다.
묻지도 따지지도 않고 주입식 교육을 한다.
교육학 2
인기 학과의 학과장이 코끼리를 냉장고에 집어넣기 100% 전형을 발표한다.
학부모가 실시한다.
교육학 3
냉장고등학교라는 이름의 학교를 개교한다. 이제 이 학교의 약칭은 냉장고이다.
이름이 '코끼리'인 학생을 입학시킨다.
이제 냉장고 안에는 코끼리가 있다.
교육학 4
여러분! 꿈을 가집시다!
코끼리를 냉장고에 넣겠다는 꿈을 가지면 누군지 코끼리를 냉장고에 넣을 수 있습니다!
꿈★은 이루어진다!
시민 혁명 이후 유냉장고 계급인 ‘닭’과 무냉장고 계급인 ‘코끼리’가 생겨났다.
닭은 냉장고에 들어감으로써 모든 이익을 독점하는 반면, 코끼리는 그럴수 없어서 모든 이익을 포기한다.
이러한 모순을 해결하기 위해 코끼리 혁명이 일어난다.
계급이 뒤집히면서 코끼리는 냉장고에 들어갈 수 있게 되어 모든 이익을 누린다.
합리적이고 이성적인 의사소통을 통해 코끼리가 냉장고 안으로 들어가도록 설득한다.
어떤 문화에 닭을 냉장고에 집어넣기 을 발생시킨다.
그 밈은 인간을 매개물로 하여 스스로를 복제한다.
어느 순간 코끼리를 냉장고에 집어넣기 밈으로의 돌연변이가 일어난다.
전자와 후자가 경쟁한다. 이 때 전자가 후자를 이긴다.

냉장고 입시 요강[원본 편집]

코끼리가 내신이 좋아 냉장과고(등학교)에 지원한다.
그런데 올해부터 냉장과학고등학교가 냉장과학영재학교로 바꿨다 카더라
코끼리는 uway.com에 50,000을 내고 입학 사정관 전형에 지원한다.
1차 시험 ; 서류평가. 코끼리는 자기소개서를 쓰고 추천서를 받아 등기로 보낸다
입학사정관이 코끼리의 중학교로 찾아와 선생님들과 면담한다.
코끼리가 1차에 합격한다.
2차는 캠프인데, 냉장과학영재학교에 가서 2박 3일간 캠프를 한다
비싼 등록금을 내고 입학한다.
코끼리의 중학교에 현수막이 붙는다.
"3학년 1반 '코끼리' 냉장고 들어가다"

경제학적 편법[원본 편집]

조건 A가 참이고, 조건 B가 전제되며, 조건 C가 성립할 때, 어디까지나 단기적으로는, 다른 모든 것들이 변하지 않는 한... 코끼리가 냉장고에 들어갔다고 가정한다.
경제학일반 2
한편으로는(On the one hand) 코끼리는 냉장고 안에 있을 것이다. 다른 한편으로는(on the other hand) 코끼리는 그렇지 않을 것이다.
코끼리에 대해서 상한가격을 설정한다.
사중손실(Deadweight Loss)이 발생한다.
냉장고에 넣으면 된다.
코끼리가 냉장고에 들어가는 것을 선택할 때, 냉장고도 코끼리를 받아들이는 것을 선호한다.
냉장고가 코끼리를 받아들이기로 했을 때, 코끼리도 냉장고에 들어가는 것을 선호한다.
따라서 코끼리가 냉장고에 들어가는 상황은 내쉬균형이다.
정부가 냉장고 규제에서 손을 뗀다.
냉장고 회사들끼리 경쟁한다.
시장을 선도하는 기업이 코끼리가 들어가는 냉장고를 출시한다.
신자유주의 2
코끼리 무리 사이에 냉장고를 던져넣는다.
코끼리끼리 경쟁한다.
능력이 우수한 코끼리가 냉장고에 들어간다.
케인즈 학파
정부가 재정을 집행하여 코끼리가 들어가는 냉장고의 수요를 형성한다.
정부가 충분히 수요를 형성하면 기업들이 코끼리가 들어가는 냉장고를 공급한다.
인센티브 이론
냉장고 안에 맛있는 풀을 넣어놓는다.
코끼리는 냉장고에 들어가서 풀을 먹을 때의 효용이 안 들어가고 밖에 있을 때의 효용보다 높다.
자신의 선호체계에 따라 코끼리는 냉장고로 들어가서 풀을 먹는다.
한계효용체감의 법칙
냉장고에 들어가지 않는 코끼리가 계속 늘어난다.
"냉장고에 들어가지 않음"의 한계효용이 체감한다.
"냉장고에 들어가지 않음"의 한계효용이 "냉장고에 들어감"의 한계효용과 같아질 때 냉장고에 들어가는 코끼리가 발생한다.
(주)냉장고를 설립한다.
유상증자를 단행한다.
자본금으로 코끼리를 구입한다.
주식시장 2
(주)코끼리의 주식을 다량 매집한다.
냉장고 하단 매수, 상단 매도를 계속하며 가격을 조정한다.
주식시장 3
(주)냉장고를 설립한다.
중소기업인 코끼리를 설립한다.
이제 냉장고가 코끼리를 인수한다.
냉장고에 코끼리 넣는 것을 아웃소싱(외주) 시켜버린다.

인문학적인 편법[원본 편집]

철학적 편법[원본 편집]

“코끼리가 냉장고에 들어갈 수 없다.”는 모더니즘적 환상을 파괴한다.
냉장고 밖에 있는 코끼리를 정이라 한다.
빈 냉장고를 반이라고 한다.
변증법적 유물론에 의해 합으로 지향한다.
철학 3
현 존재(코끼리)에 종속하고 있는 물리학적 가변성을 부정한다.
탈피함과 동시에 주체적이고 능동적인 사고를 하면, 모든 존재의 규정에서 해방될 수 있다.
철학 4
보리수는 본디 나무가 아니요,
코끼리도 본디 짐승이 아니라.
그렇다면 냉장고는 도대체 무엇이란 말인가?
신은 죽었다 -니체-
니체는 죽었다 -신-
너네 둘 다 죽었다 -화장실 아줌마-
코끼리는 죽었다 - 냉장고 -
철학 6
코끼리는 모두 超人이 되어서 냉장고 안으로 들어가야 한다!
이것은 약자의 이론을 배반하며 인간을 뛰어 넘는 것이다!
철학 7
나는 생각한다. 고로 나는 냉장고 속에 존재한다.
모든 코끼리는 다시 냉장고로 들어가게 되어 있다.
모든 코끼리는 죽으나 살으나 다 냉장고에 들어가게 되어 있다.
이것은 하나의 수레바퀴 안에서 다 같은 것이다.
개는 코끼리가 될 수 있다.
개를 냉장고에 넣는다.
명가 2
코끼리나 냉장고나 멀리서 보면 거기서 거기다.

종교적인 편법[원본 편집]

코끼리의 무덤에 굿을 한다.
그 영혼으로 하여금 냉장고를 사당으로 믿게 하여 머물게 한다.
“오오, 주여! 저는 코끼리가 냉장고로 들어갈 수 있음을 믿나이다!!”
성서해석학 1
하나님이 가라사대 코끼리가 냉장고 안에 있으라 하시매 그대로 되어
그 코끼리가 하나님 보시기에 좋았더라
-- 창세기 1장 3.5절.
성서해석학 2
내가 코끼리를 냉장고에 넣을 때에 너는 어디에 있었느냐
-- 욥기 38장 4.15926535절.
색즉시공 공즉시색이라. 코끼리를 공, 냉장고를 색으로 보고 넣는다.
냉장고의 신 코오리마토이노미코토(왜말: 氷纏命)를 모시는 신사 안에 코끼리의 신 조노미코토(왜말: 像命)를 모시는 신사의 분사를 짓는다.
알라가 코끼리가 냉장고에 들어가기를 원하신다!! جهاد!!! جهاد!!! جهاد!!! جهاد!!! جهاد!!! جهاد!!! جهاد!!! جهاد!!! جهاد!!! جهاد!!! جهاد!!! جهاد!!! جهاد!!! جهاد!!! جهاد!!! جهاد!!! جهاد!!! جهاد!!! جهاد!!! جهاد!!! جهاد!!! جهاد!!! جهاد!!! جهاد!!! جهاد!!! جهاد!!! جهاد!!! جهاد!!! جهاد!!! جهاد!!! جهاد!!! جهاد!!! جهاد!!! جهاد!!! جهاد!!! جهاد!!! جهاد!!! جهاد!!! جهاد!!! جهاد!!! جهاد!!! جهاد!!! جهاد!!! جهاد!!! جهاد!!! جهاد!!! جهاد!!! جهاد!!! جهاد!!! جهاد!!! جهاد!!! جهاد!!! جهاد!!! جهاد!!! جهاد!!! جهاد!!! جهاد!!! جهاد!!! جهاد!!! جهاد!!! جهاد!!! جهاد!!! جهاد!!! جهاد!!! جهاد!!! جهاد!!! جهاد!!! جهاد!!! جهاد!!! جهاد!!! جهاد!!! جهاد!!! جهاد!!! جهاد!!! جهاد!!! جهاد!!! جهاد!!! جهاد!!! جهاد!!! جهاد!!! جهاد!!! جهاد!!! جهاد!!! جهاد!!! جهاد!!! جهاد!!! جهاد!!! جهاد!!!
지하드!!! 지하드!!! 지하드!!! 지하드!!! 지하드!!! 지하드!!! 지하드!!! 지하드!!! 지하드!!! 지하드!!! 지하드!!! 지하드!!! 지하드!!! 지하드!!! 지하드!!! 지하드!!! 지하드!!! 지하드!!! 지하드!!! 지하드!!! 지하드!!! 지하드!!! 지하드!!! 지하드!!! 지하드!!! 지하드!!! 지하드!!! 지하드!!! 지하드!!! 지하드!!! 지하드!!! 지하드!!! 지하드!!! 지하드!!! 지하드!!! 지하드!!! 지하드!!! 지하드!!! 지하드!!! 지하드!!! 지하드!!! 지하드!!! 지하드!!! 지하드!!! 지하드!!! 지하드!!! 지하드!!! 지하드!!! 지하드!!! 지하드!!! 지하드!!! 지하드!!! 지하드!!! 지하드!!! 지하드!!! 지하드!!! 지하드!!! 지하드!!! 지하드!!! 지하드!!! 지하드!!! 지하드!!! 지하드!!! 지하드!!! 지하드!!! 지하드!!! 지하드!!! 지하드!!! 지하드!!! 지하드!!! 지하드!!! 지하드!!! 지하드!!! 지하드!!! 지하드!!! 지하드!!! 지하드!!! 지하드!!! 지하드!!! 지하드!!! 지하드!!! 지하드!!! 지하드!!! 지하드!!! 지하드!!! 지하드!!! 지하드!!! 지하드!!!

역사적 편법[원본 편집]

코끼리가 냉장고 안에서 동사하다.
위서 제작
사기(死記)를 조작해 냉장고에 코끼리가 들어갔다고 고친다.
이 글의 진위여부는 알 게 뭐야가 된다.
강제적 편법
현재 코끼리는 냉장고에 들어갔다.알겠나?
진짜 들어간다.
이 사실을 컴퓨터에 저장한다.이제 그 자료는 역사가 된다.
강제적 편법 2
코끼리를 협박한다.
코끼리가 냉장고에서 사망했음을 만천하에 알린다.
산해경속에 copy paste로 "상빙고입성"이라는 문장을 끼워넣는다.
빵상 아줌마님께 우주신께부탁해서 진실로 규명해달라고 부탁한다.
인간들이 산해경을 펼쳐보면 코끼리가 냉장고에 들어갔음을 봄으로,
과거에 냉장고에는 코끼리가 들어갔다.
그럼으로 현재에도 들어간다.
카이오지 마카이사로(왜말: 刁卜硫黄島 甲斐さろ)가 지었으나 오늘날에는 좩 렠터 니골손 발니한(듕귁어: 你首手 脚齒汗, Nicholson-Bali-Khan)만이 가지고 있는 불쏘시개 괴서 'Bellum Gollum Alpinum'에 따르면 트로이의 목마는 사실 거대한 냉장고였고, 트로이는 알프스 정상에 놓여 있었으며, 오디세우스는 낙타를 좌우에 매달은 코끼리를 타고 목마에서 뛰쳐나온 한니발의 이름이 와전된 것으로, 이것만 보아도 코끼리는 냉장고에 들어갈 수 있다는 사실이 이미 입증되었다 카더라.

언어학적 편법[원본 편집]

코끼리에 '[-voice] -> [+voice]/[+son]_[+son]'을 적용하면 코기리가 도출된다.
코기리에 '[+spread] -> [-spread]/ _#'을 적용하면 고기리가 도출된다.
고기리에 '[-spread]V1 CV2 [+lat]V3 -> [+lat]V3 [-spread]V1 CV2'을 적용하면 리고기가 도출된다.
리고기에 'NULL -> /o/ / _{[+son][+cons]}'을 적용하면 오리고기가 도출된다.
오리고기를 냉장고에 넣는다.
‘refridger [+LATINATE]’와 ‘elephant’를 합성하여 ‘refridger-elephant’를 얻는다.
verbizing suffix ‘ate’를 붙인다. 이 때, 자질을 이어받는다.
latinate nominalizing suffix ‘or [+AGENT]’를 붙인다.
refridger-elephantator가 나온다.
냉장고(refridgerator) 안에 코끼리(elephant)가 들어갔다.
Basis에서 문장 S: NP T VP를 생성한다.
NP에 적절한 명사구를 생성한다.
T에 코끼리를 접사로 생성한다.
VP의 head에 냉장고를 열어둔 채로 생성한다.
이것을 D-structure로 보낸다.
T → V 이동을 일으키면 접사하강이 발생하면서 코끼리가 냉장고 자리로 가버린다.
이것을 S-structure로 보내면 냉장고에 들어가 있는 코끼리를 볼 수 있을 것이다.
‘S1: 코끼리가 냉장고에 들어가 있다’는 ‘S2: 코끼리가 냉장고 안에 있다’를 함의하므로 S2의 진리치로써 S1의 진리치를 판단할 수 있다.
‘안에 있다 [+INSIDE]’와 ‘밖에 있다 [-INSIDE]’는 포함 관계 혹은 위치 관계를 나타내는 어휘로 묶을 수 있다.
그런데 한국어에는 위 두 단어를 아우르는 상위어가 없다. 즉 상위어에 gap이 발생한다.
gap을 메우기 위해 자질의 방향이 +인 ‘안에 있다’가 상위어로 올라가면서 중화된다.
이제 ‘코끼리가 냉장고 안에 있다’는 ‘A1: 코끼리가 냉장고 내부에 있다’와 ‘A2: 코끼리가 냉장고 외부에 있다’로 해석된다.
일반적으로 A1은 모순이고 A2는 항진이다. 한편 S2 ≡ A1 ∨ A2이므로 선언문의 정의에 의해 S2 ≡ T이다.
S2가 참이므로 S1도 참이다.
코끼리를 주어 위치에 만든다.
마침 주어 자리를 굳이 명시하지 않고도 알 수 있는 상황이 일어난다.
경제성의 원리로 감히 EPP 제약을 위반하고 코끼리의 자리를 없애 버린다.
그 빈 자리를 냉장고에 넣는다.
코끼리의 공통 조어 형태를 추적해 재구한다.
그 형태가 현재의 형태보다 짧음을 보인다.
그것을 냉장고에 넣는다.
시간이 지나면서 코끼리의 의미가 ‘코끼리과에 속하는 동물’에서 ‘회색빛을 가진 물체’로 바뀌었다.
회색 를 냉장고에 넣는다.
실험을 통해 모어 화자 어린이들이 '코끼리'를 '닭'의 의미로 처리함을 증명한다.
이제 닭을 냉장고에 넣는다.
코끼리의 어원은 ‘코 + 길이’이다. 즉 코가 긴 물체를 뜻한다.
이제 보급형 스몰 사이즈 정품 피노키오를 넣고 거짓말을 하도록 유도한다.
본래 어원에 따라 냉장고 속에 코끼리가 들어갔다.
코끼리를 영어로 번역하면 elephant가 된다.
elephant를 사전에서 검색하면 다음과 같다.
elephant (plural elephants)
  1. A mammal of the order Proboscidea, having a trunk, and two large ivory tusks jutting from the upper jaw.
  2. (figuratively) Anything huge and ponderous.
  3. (paper, printing) A printing-paper size measuring 30 inches x 22 inches.
  4. (UK, childish) used when counting to add length.
elephant³를 잘 접어서 냉장고에 넣는다.
능격-절대격 체계를 가진 언어에 ‘자동사, 타동사 - 절대격’, ‘능격 - 타동사’의 어순 규칙을 추가시킨다.
능격은 형태격이며 그 실현은 ‘를’로 한다.
술어 ‘냉장고에 집어넣다’를 타동사로 한다.
명사 ‘코끼리’는 동작주와 피동주, 모두 가능하도록 한다.
‘코끼리를 냉장고에 집어넣다.’는 코끼리가 무언가를 냉장고에 집어넣는다는 뜻이다.
위의 정의에 따라 ‘코끼리를 냉장고에 집어넣을’ 수 있다.
인공 언어
코끼리와 이 동음어 혹은 동형어인 언어를 창작한다.
그 언어를 사용하는 화자가 닭을 냉장고에 넣는다.
코끼리가 방에 들어갔다.
코끼리 가방에 들어갔다.
이제 가방을 냉장고에 넣는다.
언어 습득 이론
어떤 아이에게 ‘닭’ 이라는 대상을 ‘코끼리’라고 부르도록 가르친다.
그 아이가 성인이 되면 닭을 냉장고에 넣는 행위를 ‘코끼리를 냉장고에 집어넣는다’고 표현할 것이다.
옛날 옛적에 코끼리는 냉장고에 들어갈 수 있었다.
시대가 변하면서 코끼리는 냉장고에 들어갈 수 없게 되었다.
하지만 여전히 전통문법을 고집한다.
따라서 코끼리가 냉장고에 들어가지 않는 것은 비문법적이므로 존재할 수 없다.
코끼리와 닭의 사이의 음운 대응을 발견한다.
이제 닭을 냉장고에 넣는다.
signifie ‘닭’의 signifient은 ‘코끼리’임을 보인다.
signifie ‘닭을 냉장고에 넣는 행위’의 signifient은 ‘코끼리를 냉장고에 넣다’이다.
원래 코끼리는 냉장고 안에 있었다.
그런데 원인 모를 이유로 인해 코끼리를 냉장고 밖으로 꺼내는 변형이 일어났다.
C1에서 제 1논항은 ‘코끼리’이고 P는 ‘냉장고 밖에 있다’, 제 2논항은 ‘아무 것’이다.
수동변형을 가하면 제 1 논항이 해고된다.
C2에서‘코끼리’와 ‘냉장고 밖에 있다’의 문법적 관계는 끊어졌다.
‘밖’ 아니면 ‘안’이므로, 코끼리는 문법적으로 냉장고 안에 있다.
‘코끼리를 냉장고에 집어넣는다’는 문장을 만든다.
사실 모든 것은 냉장고에 들어간다.
다만 코끼리가 냉장고에 들어가는 것은 LF에서 일어나기 때문에 보이지 않는 것 뿐이다.
최적성 이론
술어 ‘냉장고에 집어넣다’에 대해 다음과 같은 제약이 있다.
A: 피동주는 생명체이다
B: 피동주는 3음절이다
C: 피동주는 길게 돌출된 부분을 가진다
D: 피동주는 술어가 지칭하는 것에 포함될 수 있다
제약의 위계는 A>B>C>D이다.
‘s: 닭을 냉장고에 집어넣다’는 제약 B,C를 위반한다.
‘t: 오리고기를 냉장고에 집어넣다’는 A,B,C를 위반한다.
‘u: 코끼리를 냉장고에 집어넣다’는 D를 위반한다.
따라서 가장 최적의 문장인 u가 도출된다.
언어 유희 1
코들을 자른다.
냉장고에 넣는다.
코끼리 냉장고에 들어갔다.
언어 유희 2
냉장고등학교를 설립한다.
별명이 코끼리인 학생을 입학시킨다.
언어 유희 3
어떤 꼬마에게 스페인어로 "El Efante"라는 별명을 준다. 그 꼬마를 잠시 냉장고에 들여보낸다.

문화·예술적인 편법[원본 편집]

일반 예술적 편법[원본 편집]

미술 2
상자 안에 무언가를 넣는다.
살아 있는 자의 마음에서 불가능한 물리학적 코끼리의 냉장고로의 들어감》이라는 제목을 붙인다.
현대미술전에 출품한다.
코끼리가 들어가는 냉장고를 디자인한다
엔지니어가 만든다
《A piece for Piano, Elephant》라는 제목을 붙인다.
냉장고에 넣는다.
음악 2
곡들을 모아 《Pieces for Piano, Fridge》라는 제목을 붙인다.
한 곡을 골라 〈No. 1, Elephant〉라는 제목을 붙인다.
음악 3
소나타나 발라드와 같이 냉장고라는 이름의 악곡 형식을 만든다.
그 형식대로 곡을 휘긴다.
작품번호를 Op.25 No.81으로 정하고, 부제목을 코끼리로 정한다.
그 곡의 이름은 < - Piano Fridge Op.1 No.1 “Elephant”>이다.
출판사에 냈을 때 곡집을 만들어 줄지 안만들어 줄지는 모르겠지만, 만들어 준다면 부제목이 '코끼리'인 곡은 '냉장고' 곡집에 있는 곡이다.
스티븐 스필버그에게 시킨다.
연극영화 2
심형래에게 시킨다.
난해한 춤을 춘다.
코끼리가 냉장고에 들어가는 것을 형상화했다고 해설한다.
나니아 연대기
아이들은 냉장고 문을 열었고,
그속에는 환상의 나라 나니아와 위대한 코끼리 아슬란이...
종이접기책에서 코끼리를 설명대로 접는다.
종이로 접은 코끼리를 냉장고에 넣는다.
텔레스크린에다가 트럼펫 소리와 함께 "국민 여러분! 코끼리가 냉장고 안에 들어가 있습니다!" 라고 방송한다.
그럼 그순간부터 원래 코끼리는 냉장고 안에 들어가 있었다. 만약 부정하는 자가 있다면, 빅브라더가 코렁탕을 사주며 설득할테니 걱정하지 않아도 된다.

문학적 편법[원본 편집]

냉장고가 열렬한 사랑에 빠졌다.
이제 코끼리는 냉장고의 가슴속에 오래오래 있을 것이다.
(다른사정은없는 것이차라리나았소.)
냉장고에 코끼리를 넣은 1人
냉장고에 코끼리를 넣은 2人
냉장고에 코끼리를 넣은 3人
냉장고에 코끼리를 넣은 4人
냉장고에 코끼리를 넣은 5人
냉장고에 코끼리를 넣은 6人
냉장고에 코끼리를 넣은 7人
냉장고에 코끼리를 넣은 777人
냉장고에 코끼리를 넣은 778人
냉장고에 코끼리를 넣은 779人
냉장고에 코끼리를 넣은 780人
냉장고에 코끼리를 넣은 1004人
냉장고에 코끼리를 넣은 782人
냉장고에 코끼리를 넣은 783ㅅ
人을 못 쓰고 ㅅ을 쓴 사람이 안쓰러운 1人
人을 못 쓰고 ㅅ을 쓴 사람이 안쓰러운 2人
人을 못 쓰고 ㅅ을 쓴 사람이 안쓰러운 3人
人을 못 쓰고 ㅅ을 쓴 사람이 안쓰러운 4人
人을 못 쓰고 ㅅ을 쓴 사람이 안쓰러운 5人
人을 못 쓰고 ㅅ을 쓴 사람이 안쓰러운 6人
人을 못 쓰고 ㅅ을 쓴 사람이 안쓰러운 7人
人을 못 쓰고 ㅅ을 쓴 사람이 안쓰러운 8人
人을 못 쓰고 ㅅ을 쓴 사람이 안쓰러운 9人
人을 못 쓰고 ㅅ을 쓴 사람이 안쓰러운 10人
人을 못 쓰고 ㅅ을 쓴 사람이 안쓰러운 11人
人을 못 쓰고 ㅅ을 쓴 사람이 안쓰러운 12人
人을 못 쓰고 ㅅ을 쓴 사람이 안쓰러운 13人
人을 못 쓰고 ㅅ을 쓴 사람이 안쓰러운 14人
人을 못 쓰고 ㅅ을 쓴 사람이 안쓰러운 15人
人을 못 쓰고 ㅅ을 쓴 사람이 안쓰러운 16人
人을 못 쓰고 ㅅ을 쓴 사람이 안쓰러운 17人
人을 못 쓰고 ㅅ을 쓴 사람이 안쓰러운 18人
人을 못 쓰고 ㅅ을 쓴 사람이 안쓰러운 19人
人을 못 쓰고 ㅅ을 쓴 사람이 안쓰러운 20人
... 이렇게 '냉장고에 코끼리를 넣은 n人'이 묻히면 다시 다른 사람이 '냉장고에 코끼리를 넣은 1人'을 쓴다.
계속 된다.
Answer to Life.png를 넣는다.
, 우주, 그리고 모든 것에 대한 궁극적 해답이 냉장고 안에 있으므로, 코끼리도 냉장고 안에 있다.
내가 그의 이름을 불러주었을 때
그는 냉장고로 들어가 코끼리가 되었다.
“글쎄 말이지. 이번 앤 꽤 여러 날 앓는 걸 약도 변변히 못써 봤다더군.
지금 같아서 윤 초 시네도 대가 끊긴 셈이지. ……
그런데 참, 이번 코끼린 어린 것이 여간 잔망스럽지가 않아.
글쎄, 죽기 전에 이런 말을 했다지 않아? 자기가 죽거든
꼭 그대로 냉장고에 넣어 달라고 …….”
“네 소원이 무엇이냐?”하고 하느님이 물으시면 나는 서슴지 않고 내 소원은 코끼리가 냉장고에 들어가는 것이라 대답할 것이다. “그 다음 소원은 무엇이냐?”하면 나는 또 코끼리가 냉장고에 들어가는 것이라 할 것이오. 또 “그 다음 소원이 무엇이냐?”하는 세번째 물음에도 나는 더욱 소리를 높여서 나의 소원은 코끼리가 완전히 냉장고 안에 들어가는 것이라고 대답할 것이다.
어린 왕자
나는 더 이상 참을 수가 없었다. 게다가 고장난 비행기를 서둘러 손봐야 했다.
그래서 되는대로 아무렇게나 그리고서 아이에게 그림을 내밀었다.
"이건 냉장고야, 네가 갖고 싶어하는 코끼리는 이 속에 들어 있어."
그때 아이의 얼굴이 환하게 밝아지는 것을 보고 나는 깜짝 놀랐다.
대체 역사 소설
냉장고가 엄청 크게 만들어졌었다는 대체 역사(alternative history)를 설정한다.
님의 침묵
님은 갔습니다. 아아 사랑하는 님은 갔습니다
푸슨 산빛을 깨치고 냉장고를 향하여
난 작은 길을 걸어서 차마 코끼리를 들고 갔습니다
황금의 꽃 같이 크고 빛나던 옛 코끼리는
차디찬 고기가 되어서 한숨의 미풍에 냉장고로 날아갔습니다.
날카로운 코끼리의 추억은 나의 운명의 지침을 돌려놓고
뒷걸음 쳐서 냉장고로 사라졌습니다.
"냉장고를 사다 놓았는데 왜 들어가질 못하니,왜 들어가지를 못하니...... 괴상하게도 오늘은 운수가 좋더니만....."
저항 문학
다시 천고(千古)의 뒤에
백마타고 오는 코끼리가 있어
이 냉장고에서 목놓아 부르게 하리라
코끼리 함부로 냉장고에 넣으려 하지 마라.
너는 한 번이라도
차가운 냉장고 안에 들어가본 사람이었느냐?
이것은 소리 없는 아우성
저 푸른 냉장고를 향하여 흔드는
영원한 노스탤지어의 코끼리.
차가움은 물결같이 냉장고에 나부끼고
오로지 맑고 곧은 이념의 코끼리 끝에
냉장고는 백로처럼 날개를 펴다
아! 누구인가?
이렇게 슬프고도 애달픈 코끼리를
제일 먼저 냉장고에 넣을 줄 아는 그는
어두운 분위기의 문학
나는 코끼리로소이다. 나는 코끼리로소이다.
나는 냉장고에 들어가 있는 어여쁜 아들인 코끼리로소이다.
여기서 코끼리가 냉장고로 들어간다고 했을 때, '코끼리'를 A라고 놓는데 이 때 A는 모든 코끼리를 지칭하지만 이 '모든'이라는 사전적 의미는 전 지구상뿐 아니라 현존하는 모든 우주 속, 즉 빅뱅 이론에 의해 최초로 우주가 탄생한 시작점에서 137억 광년 떨어진 모든 구 속의 코끼리를 지칭하는 것이다. 또한 여기서 '코끼리'는 우주의, 이를테면 윤희의 왕국인 윤희왕국에 의해 통치되는 안드로메다의 코끼리의 '개념'과 지구의 '코끼리'의 개념은 같을 수 있으나 그 문자가 다를 수 있기 때문에 '이것은 파이프가 아니다'라는 그림으로 초현실주의에 입각, 이 때 초현실주의란 마그리트 외의 '나와 마을'의 샤갈과 '시간의 충고'의 달리 등과 같이 현존할 수 없는 상상의 그림을 그림으로 그리는 모순적인 상황을 타파한 화가들을 의미하며, 허튼 마그리트의 '이미지의 배반'에 의해 서로 같은 개념을 다른 말로 통칭하는 동개념타어의 의미를 구별하기 위해 여기서 '코끼리'라고 적는 것은 말로서의 '코끼리'가 아닌, 어떠한 같은 개념을 나타내는 다른 말 속에서 통칭되어지는, 그러나 이 때 '통칭되어지는'이란 '통칭하는'의 수동형으로, 한구거는 수동형, 다른 말로는 '피동형'을 제대로 사용하지 않기 때문에 이는 영어 공용화 사이에서 생겨난 한국인의 특징으로, 비슷한 예로는 명사보다 대명사를 더 잘 쓰는 한국인의 소설들에도 드러나며, 이에 반대하여 대명사를 거의 쓰지 않고 힘들어도 굳이 명사만으로 소설을 써나간 뒤치닥(대표작 : 투명드래곤)에 대해서 제대로 된 이해가 필요하게 된 상황을 토대로 하여 의미를 다시 쓰게 되면, '임의의 다른 말에 의해 지구의 '코끼리'라는, 제 15번 염색체의 제 256번째 대구 사이의 제 14열의 생물학적 유전 암호, 여기서 유전 암호란 티민, 아데닌, 시토신, 구아닌으로 이루어진 4가지인데 여기서 '구아닌'이란 포유류의 눈동자 혹은 물고기의 비늘에 들어간 화합물이 아닌, '디옥시리보오스 뉴클리어 구아닌(DNN)'을 의미하게 되어, 이런 4가지 유전암호로 이루어진 GTACCTAGCATTTACGATATTAAA로 이루어졌는데, 여기서 맨 앞의 GTA는 실제로 쌀국에서 내놓은 본격 파괴 게임이 아닌 제대로 된 '구아닌' '티민' '아데닌'으로 되어 있는데 이것이 만일 tRNA에 의해 재복사 되어 '시토신' '아데닌' '우라실'로 번역되어지는, DNA와 RNA 사이의 '티민'과 '우라실' 사이의 문제로 인해 제대로 된 번역을 하기 위해 둘을 혼동하지 않아야 한다는 생물학적 특색을 알아야만 알 수 있는 유전 암호를 해석시 나타내는 같은 '동물'적 개념, 여기서 동물이란 단순히 움직이는 생물체가 아닌, 감정을 제대로 느끼는 생물, 여기에서 '이성'으로 '감정'을 통제하는 사람은 제외되는데, 사람의 '감정'을 굵은 색채로 표현한 야수파, 여기서 야수는 미녀와 야수에 나오는 미남이 아닌 동물의 왕국에서 베어 그릴스가 한 끼 점심 식사로 대접받은, 이로 인해 생긴 수동형을 다시 바꾸면 '야수는 한 끼 점심 식사로 자신을 베어그릴스에게 대접했다'라고 불리는 문장에 의해 생겨난 야수와 같이 감정을 절제하지 않는 인간들의 그림에 의한 야수파를 모두 포함한 생물을 '동물'이라고 하는데, 이런 유전 암호와 생물학적 의미로 해석된, 여기서 해석이란 단순히 '한 언어를 다른 언어로 번역' 하는 구글 번역기를 이야기 하는 것이 아닌, 한 개의 지적 통칭어를 다른 지적 통칭어, 즉 예를 들면 윤희코드와 같은 것으로 바꿔주는 행동을 통해 생겨난 것을 A라고 놓는다. 이렇게 코끼리에 대한 정리가 모두 끝났고 이제 냉장고를 B라고 하면 집합학에 따라 A<B인데, 여기서 원래는 U를 극좌표계에 나타내어 허수, 즉 이차방정식에서 실수 상에 존재하지 않는, 음수에 루트를 씌운, 여기서 루트란 뿌리라는 의미가 아닌 '제곱근'의 의미를 통칭하여, 제곱하면 원래의 수가 되는 양의 실수를 통칭하게 되는데, 이렇게 -1의 '제곱근'을 U를 나타낸 극좌표계에 곱해 생긴 글자를 < 대신 놓아야 하나 이는 백괴사전에서 주축으로 하는 컴퓨터 언어인 윤희코드를 제대로 알지 못하면 쓸 수 없으나, 는 너무 유식해서 이런 것들은 뇌 용량 한 구석에 박혀있다는 것을 인지하지 아니하지 아니하지 않고 이를 한국어로 표현하게 되었을 때 A는 B의 부분집합인데, 여기서 부분집합은 진부분집합과 A=B와 같은 경우를 모두 합치는 경우를 말하게 되며, 이 때 A와 B의 관계를 증명하고 싶지만 여백이 모자라 여기에 적을 수 없음을 유감으로 생각하는 바이지만 여기서 '유감'이란 윤희코드 중 한자로 나타낸 2글자의 한자어로, 이로 인해 '유감'이란 마데 인 치나임이 논증되게 되는데, 이 때 논증이란 단어는 '논하여 증명한다'라는 7단어를 4단어로 줄이는 농담 따먹기에서 창출된 산물을 말하는데, 이는 여러 DC인의 산물로 만들어진 것으로, 이는 대한민국에서 배포하는 자본주의와 어긋나 반공이라는 단어를 먹고 촛불시위에 의해 물호스를 뿌리게 된 다음 38선을 거쳐 북조선으로 넘어가 다이나믹 로동을 하게 될 지언저, 결국 논증을 하게 되어 생긴 '유감'의 의미에 따라, 이로 인해 여백이 모자라게 된 한 불쌍한 중생을 위해 이에 대해 서론을 끝내게 되어 슬슬 본론으로 넘어가게 되는데 더 이상의 자세한 설명은 생략한다.

클로디어스: 아, 햄릿, 코끼리는 어디 있느냐?
햄릿: 식사중입니다.
클로디어스: 식사중이라니, 어디서?
햄릿: 먹고 있는 중이 아니라 먹히고 있는 중입니다. 지금 정치 구더기들이 모여서 한창 먹고 있는 중입니다. 구더기란 식충이 제왕이거든요.
우리는 우리가 살찌자고 다른 동물을 살찌게 하고, 코끼리가 살찌는 것은 구더기를 살찌게 하는 것입니다. 살찐 코끼리나 여윈 코끼리나, 맛은 다르지만 같은 식탁에 오른 두 접시 요리랄까요. 결국은 마찬가집니다.
클로디어스: 원, 이것 참!
햄릿: 코끼리를 뜯어먹는 구더기를 미끼로 붕어를 낳고 그 구더기로 살찐 그 붕어를 냉장고가 먹고, 그렇습니다.
클로디어스: 무슨 소리냐, 그건?
햄릿: 그저, 코끼리도 냉장고 속을 순회할 수 있다는 것을 말씀드린 것뿐입니다.
클로디어스: 코끼리는 어디 있느냐?
햄릿: 천당에 있습니다. 사자를 보내서 알아보십시오. 만약 찾아오지 못하거든, 자신께서 몸소 또 다른 지옥에 가서 찾아보십시오.
그러나 이 달 안에 정 찾아내지 못하시거든, 냉장고를 뒤져 보십시오. 거기서 냄새가 날 테니.

서브컬쳐 문학적 편법[원본 편집]

  • 공의 경계에 의하면 코끼리를 냉장고에 넣을 수 있는 능력자가 이 세상에 적어도 한명 있다고 한다.
러시아식 유머
  • 러시아식 유머에 의하면 러시아에서는 냉장고가 코끼리 안에 들어간다.
  • 위 문장에 한번 더 러시아식 유머를 적용하면 코끼리에 의하면 러시아식 유머에서 냉장고가 러시아 안에 들어간다.라는 문장이 된다.
  • 코끼리는 참이다.
  • 따라서 러시아식 유머에서 냉장고가 러시아 안에 들어감을 보인다.
  • 위 문장에 러시아식 유머를 적용하면 러시아에서 러시아 에서 러시아식 유머가 냉장고 안에 들어감을 보인다.가 된다.
  • 앞의 러시아에서가 2번 나온 것을 한번으로 줄인다.
  • 즉, 이제 원 명제는 러시아에서 러시아식 유머가 냉장고 안에 들어간다.가 된다. 이는 러시아식 유머를 쓴 종이를 냉장고 안에 넣으면 되므로 , 참이다.

따라서 냉장고에 코끼리를 넣을 수 있다.

만화 · 애니메이션에서의 편법[원본 편집]

사우스 파크
아프리카에서 케니를 냉장고 안에 넣는다
코끼리떼가 케니를 죽이기 위해 냉장고 안으로 돌진한다.
OMG! They killed Kenny! U bastards!
사우스 파크 에서의 다른방법
카트맨의 에 코끼리를 넣는다. 디즈니랜드도 들어가는데 당연히 들어간다.
카트맨을 냉장고에 넣는다.
그러나 카트맨이 뚱보여서 들어갈지는 의문이다.
아무 년 아무 월 아무 일 아무 시 아무 분 아무 초
코끼리, 냉장고 안에서 동사.
- 코끼리가 심장마비로 죽으면 낭패
천원돌파 그렌라간
코끼리는 죽었어! 이제 없어!
이제 코끼리가 가 되었으니까 냉장고에 넣는다.
천원돌파 그렌라간 2
코끼리는 죽었다.
그러나 코끼리는 냉장고 안에 하나되어 계속 살아간다.
코끼리가 서식하는 행성의 이름을 냉장고로 바꿔 부른다
코끼리가 에게 에서 냉장고에 들어간다는 미래 노트를 쓴다.
도라에몽 2
코끼리를 4차원 주머니에 넣는다
4차원 주머니를 냉장고 안에 넣는다
도라에몽 3
스몰 라이트로 코끼리를 작게 만든다
코끼리를 냉장고 안에 넣는다
도라에몽 4
빅 라이트로 냉장고를 크게 만든다
코끼리를 냉장고 안에 넣는다
도라에몽 5
코끼리를 타임 보자기로 싼다
이제 코끼리를 꺼내 새끼코끼리 또는 그 외의 물질이 되었는지 확인한다
그게 뭐던 간에 냉장고에 넣는다
반숙은 15분, 완숙은 20분 뭐가 나올진 알 게 뭐야
도라에몽 6
코끼리를 타임 보자기로 싼다
소원요정에게 코끼리가 냉장고에 들어가게 해 달라고 빈다
명탐정 코난
사건-누군가 냉장고에 들어갔다.
코끼리-증거 있어?(코끼리가 말할 수 있는지는 알 게 뭐야)
코난-그럼 있지! 그러나 자세한 설명은 생략한다.
키테레츠 대백과
Talk.svg한지수(돼지고릴라)이(가) 기차 화통을 삶아먹습니다(응?) “야, 발명왕! 코뿔소를 냉장고에 넣는 기계 못 만드냐?”
Talk.svg마마준(삐죽이)이(가) 말씀하십···(응?) “야, 코끼리겠지.”
Talk.svg강기태(발명왕)이(가) 읊조립···! “야, 그런 기계가 어딨냐?”
Talk.svg코로스케가 타박합···?! “무사는 코끼리 정도야 냉장고에 넣는 건 간단하다오!
코끼리한테 축소광선을 쏴서 줄인 다음에 넣어 보시오!”
최강합체 믹스마스터
슈퍼 울트라 어저구저쩌고 최강 합체!
프리지 워리어!
코끼리 모치를 해치워!
코어포스 리턴!
그리하여 코끼리의 코어포스는 믹스슈터에 들어가게 되었다능.(믹마공식:믹스슈터=냉장고)
코끼리를 냉장고에 넣는다는 것, 그것은 상식을 파괴해야 한다는 것───────────을 말하고 있는 것인가────────
고요한 정적,
코끼리에게, 살해당한다──────!
<BAD END> 시에루 선생님의 수업을 받으시겠습니까? / 아니오
쿠소미소(엉망진창) 테크닉
"젠장 더워. 끈적끈적 하다고."
지금 축사로 달려가고 있는 나는 동물원에 있는 평범한 코끼리다.
특히 끌리는 게 있다면 냉장고에게 흥미가 있달까...
그런 연유로 돌아오는 길에 있는 공원 안 화장실까지 오게 되었다.
문득 옆을 보니까 냉장고 한 대가 놓여져 있었다.
'우홋! 좋은 냉장고!'
그렇게 생각하고 있으니 갑자기 그 냉장고가 내가 보는 앞에서 문을 열기 시작했다.
"들어 오지 않겠는가?"
웹툰 1
코끼리에게 심장병을 걸리게 한다.
나운규한테 부탁해서 냉장고에 코끼리의 영혼을 이식시킨다.
자세한건 네이년 웹툰을 찾아보게나.
웹툰 2
코끼리를 마구잡이로 팬다.
머리에서 인공소자를 꺼내 나노혼합액에서 뇌를 성장시킨뒤 냉장고에 넣는다.
자세한건 네이년 웹툰을 찾아보게나.

주의! : 이 방법을 쓰면 코끼리의 뇌가 주변의 음식물을 끌어당기며 크고 강해질 수 있으니 조심하자.

웹툰 3
미술사 페이지의 '차례' 목록 맨 끝에 '냉장고'를 적어넣어 새로운 페이지를 만든다.
이제 코끼리를 미술사로 보낸 다음 반 메헤렌을 보내 냉장고로 보낸다.
자세한건 네이년 웹툰을 찾아보게나.
웹툰 4
난 코끼리가 냉장고로 들어가는 것을 허락하지 않았다.
웹툰 5
코끼리가 냉장고에 들어간다고? 뭐 새삼
 자세한건 네이년 쥐덫 만화를 찾아보게나.
마다가스카의 펭귄
네 가지의 방법이 있다
  1. 소요시간 712년 걸리는 축소광선 레이더를 제작한다
  2. 소요시간 6 9년?걸리는 비행기를 제작한다
  3. 이미 완성된 축소광선총을 이용한다
  4. 역시 완성된 슈퍼광선을 이용한다
1번?방법은 축소되는 비율이 꽤 크다
완성되기를 기다리느니 차라리 코끼리가 작아지기를 기다리는 게 낫지
2번?방법으로 코끼리를 깔아뭉개고 냉장고에 처넣는다
위험하나 재미있는 방법이다
3번? 다들 아시죠?ㅎㅎ
알 게 뭐야
4번? 뭐? 코끼리가 커진다고? 멍청아 냉장고를 커지게 하는거야
무생물은 안커진다ㅇㅂㅇ
마다가스카의 펭귄-2
스키퍼 : 코끼리 우리 얼리기 작전을 시작한다
마다가스카의 펭귄-3
리코의 뱃속에 냉장고가 있다
이제 리코는 코끼리만 삼키면 된다
마음의 소리
저쪽 남자분이 넣어주시는 겁니다.
코리갑?을 몬스터볼에 집어 넣는다.
몬스터볼을 냉장고에 넣는다.

마법소녀 마도카 마기카
코끼리를 큐베와 계약시켜 소울젬을 만든다.
이제 코끼리의 육신은 빈 껍데기일 뿐이며, 소울젬이 진짜 코끼리가 되었다.
소울젬을 냉장고에 넣는다.
아기새가 크리스마스 선물로 '냉장고에 들어간 코끼리'를 받고 싶다고 한다.
그러면 나유진 여사께서는 알아서 냉장고에 코끼리를 넣어서 아기새에게 선물해준다.
북두의 권 1
코끼리에게 북두백렬권을 시전한다.
몇 초 후 코끼리는 외마디 비명과 함께 터진다.
터진 코끼리를 주워 냉장고에 넣는다.
북두의 권 2
코끼리 뒤에 냉장고를 두고 문을 열어놓는다.
코끼리에게 잔회적보권을 시전한다.
비공 '슬한'을 찔린 코끼리는 자신의 의지와 상관없이 계속 뒤로 걸어가게된다.
결국 알아서 냉장고에 들어가게된다.
어떤 마술의 금서목록
엑셀러레이터가 코끼리를 만지면 모든 벡터가 지맘대로다.
엑셀러레이터가 실실 쪼개면서 코끼리를 냉장고에 넣는다.
미라클 라이트의 힘을 빌려 코끼리를 냉장고에 넣는다.
유노가 일본도로 코끼리를 토막내서 냉장고에 넣는다. 유키테루는 옆에서 이런저런 생각만 하고 있는다.
죠죠의 기묘한 모험
코끼리를 냉장고에 넣는 스탠드 능력이 발현된다
이 멋진 세계에 축복을!
주문은 토끼입니까?
티미의 못말리는 수호천사
코스모와 완다에게 코끼리를 냉장고 안에 집어넣어 달라고 부탁한다.
데이트 어 라이브
시원찮은 그녀를 위한 육성방법

레크리에이션·스포츠에서의 편법[원본 편집]

당구대에 코끼리와 냉장고를 놔둔다.
코끼리를 큐로 쳐서 3가락을 돌린다.
코끼리가 뽀록으로 냉장고에 들어간다.
象이라고 적힌 장기알을 냉장고에 넣는다.
먼 미래 월드컵 축구 공인구의 이름은 '코끼리'다.
빙하기라 골대도 얼음으로 만들어져 냉장고가 따로 없다.
누군가 '코끼리'를 '냉장고'에 넣게 된다.

게임에서의 편법[원본 편집]

메탈슬러그 3
설인 동굴에서 돌아올때 엘리펀트 슬러그(코끼리)를 타고 간다.
동굴 마지막에 가면 얼음연못에 빠진다.
크레이지 아케이드의 캐릭터
에취모수에게 부탁하면 잘 될 것이다.
만약 그렇게 되지 않는다면, 다오오메가메가 버블범버로 처넣는다.
슈퍼 마리오
냉장고에게 버섯을 먹인다.
코끼리는 밟아서 꼬마로 만든다.
스테이지 클리어
슈퍼 마리오 브라더스 X
world 폴더에 Refrigerator 폴더를 생성한다.
그 폴더 안에 Elephant.lvl 파일 생성
젤다의 전설 무쥬라의 가면
가면상인에게 코끼리 가면을 얻는다
링크가 그 가면을 써서 코끼리로 변한다
링크가 냉장고 안으로 들어간다
젤다의 전설 이상한 모자
코끼리에게 이상한 모자를 씌운다.
나무위에 서서 이상한 주문을 외우면
코끼리가 땅콩된다
픽콜의 도움을 받아 냉장고로 가자
젤다의 전설 바람의 택트
코끼리를 툰렌더링화 시킨다
이제 링크는 툰렌더링화 된 코끼리를 냉장고에 던진다
젤다의 전설 황혼의 공주
코끼리를 포박한다.
현자들이 코끼리를 검으로 처형한다.
그런데 신의 장난인지 코끼리는 신에게 선택받았다.
당황한 현자들이 거울을 냉장고에 비춰서 코끼리를 냉장고 세계로 보내버린다.
링크가 코끼리를 턴다.
별의 커비
냉장고 속에 커비를 넣는다.
커비가 코끼리를 빨아먹는다.
커비가 코끼리처럼 커질지는 알 게 뭐야.
현질 앤 파이터 1
코끼리가 냉장고에 들어가는 것은 불가능한 일입니다만.
그러나 그것이 실제로 일어나고 말았습니다!!!
현질 앤 파이터 2
'냉장고'라는 NPC를 제작한다.
그 뒤에 동물원이라는 만렙만 들어갈 수 있는 던전을 제작한다
보스를 코끼리로 칭하고 피를 노말70줄,익스80줄,마스터90줄,킹스120줄로 설정한다.
그 뒤에 '동물원; 던전의 킹스로드 이상에서 보스 '코끼리'에게 얻을 수 있는 코끼리의 시체를 가져오라는 에픽퀘를 만든다.
단 파티로 들어갈 수 없다는 규제를 설정한다.
만약 이 퀘스트를 렙70이 된지 5일않에 실행하지 않는다면 그 캐릭터의 아이템을 몰수시킨다.
퀘스트 완료시 보상 10골드를 받는다.
현질 앤 파이터 3
'코끼리의 약속' : 11700원, 사용 시 코끼리가 냉장고에 들어가는 것이 실패해도 재시도가 가능하게 만듭니다.
'코끼리의 믿음' : 36700원, 사용 시 코끼리가 냉장고에 들어갑니다.
더 심즈
집 이름을 '냉장고'라고 짓는다.
그 뒤에 심을 만들어 이름을 '코끼리'라고 짓게 한 뒤 아까 만든 집으로 이사시킨다.
주 타이쿤
동물 우리를 만든다.
그 우리에 코끼리를 넣는다.
코끼리 우리 이름을 '냉장고'로 바꾼다.
같은 날 어느 시각
냉장고 내부
이 메시지를 본 후 코끼리를 만나거나, 증거품 코끼리를 받거나 이 부분이 코끼리의 시점이라면 코끼리는 이미 냉장고 안에 있다.
코끼리에게 곡옥을 제시해 코끼리가 냉장고에 들어갈 수 있음을 알아낸다.
냉장고 안에 들어간 뒤 코끼리를 영매한다.
아카네 1
코끼리를 과학적으로 집어넣는다.
아카네 2
들어갈 때까지 맛동산으로 때린다.
증인석에 냉장고를 세운다. "꿰뚫어보기"에서 냉장고의 빈 틈을 찾아내고 증거품 "코끼리"를 제시한다.
신곡 가사에 "코끼리는 냉장고로"라는 구절을 삽입한다.
미츠루기 (역전검사)
로직 모드로 들어간다. "실종된 코끼리"와 "냉장고에서 내용물 반응"의 2개를 조합하면 "냉장고의 내용물은 코끼리다"라는 결론을 얻는다.
맵 에디터로 벙커를 '냉장고'로 마린을 '코끼리'로 수정하여 플레이한다.
홍진호임요환에게 냉장고링을 당한다.
스타크래프트 2
'냉장고' 맵을 만든다.
저그 종족으로 플레이한다.
울트라리스크를 뽑는다.
스타크래프트 3
아비터를 냉장고에 넣는다?
코끼리를 리콜한다.
스타크래프트 4
Move [All] [Elephant] for [All Player] at '[Anywhere]' to '[Refrigerator]'.
Preserve trigger.
스타크래프트 5
맵 에디터로 드랍쉽 이름을 '냉장고' 로 고친다.
울트라리스크를 넣는다.
스타크래프트 6
'코끼리_핵.exe' <<< 즉시 다운.
사용을 했는데 상대방이 아쿠아 런처를 사용했다면 알 게 뭐야.
스타크래프트 7
아비터의 스테이시스필드를 울트라에게 사용한다.
스타크래프트 8
지형이 Ash World 로 된 맵을 하나 만든다.
저그의 공중유닛과 울트라리스크를 제외하고 모든 유닛의 이름을 코끼리로 바꾼다.
버러우 기술을 업그레이드 하여 눈밭에 버러우 시킨다.
스타크래프트 8
EUD 라는 프로그램을 이용하여 울트라리스크를 버러우 시킬수 있게 한다.
지형이 Ash World 로 된 맵에다가 울트라리스크를 버러우 시킨다.
스타크래프트 9
아칸을 50개이상 배치하고 그 아칸의 중심에 울트라리스크를 배치한다.
아칸은 사실 모습은 하얗지만 몸은 뜨겁다. 그래서 냉장고라 할 수 없지만 알 게 뭐야.
스타크래프트 10
해처리의 이름을 냉장고, 라바의 이름을 코끼리로 한다.
그럼 해처리(냉장고)에서 라바(코끼리)가 생성된다.
냉장고에서 코끼리가 나온다는것은 코끼리가 냉장고 안에 있었다는 것이니 코끼리는 냉장고 안에 들어갈 수 있다는 공식이 성립된다.
스타크래프트 11
파일런의 이름을 냉장고로 한다.
파일런을 클릭하면 푸른 원이 보일텐데 그 원에다 울트라리스크를 둔다.
스타크래프트 II
맵 에디터로 사령부의 이름을 냉장고로 바꾸고 건설로봇의 이름을 코끼리로 바꾼다.
건설로봇을 사령부로 들인다.
"냉장고"라는 맵에 "코끼리"라는 몬스터가 젠되게 한다.
메이플스토리 2
캐시템을 사면 가능하다.
메이플스토리 3
메뉴에서 "농장가기" 를 누르면 백괴스러운 농장이 하나 생성된다.
그 농장의 이름을 냉장고로 설정한다.
그 농장에 몬스터를 만든후 몬스터의 이름을 코끼리로 한다.
그럼 코끼리 같지않은 코끼리가 농장에있지만 알 게 뭐야.
메이플스토리 4
"냉장고"라는 이름으로 길드를 만든다.
"코끼리"라는 닉네임의 유저를 초대하여 가입시킨다.
메이플스토리 5
"냉장고" 패치를 한다.
신서버를 만들고 "냉장고"라는 이름을 붙인다.
그 뒤 한 유저가 캐릭터를 만들고 "코끼리"라는 이름을 붙인다.
냉장고를 코끼리 앞에 데려다놓는다.
냉장고 안에 들어간다.
소환비서를 쓴다.
※ 자신이 코끼리보다 레벨이 낮을경우 소환비서 사용이 되지 않습니다.
보통 퓌예로가 하는 방법으로 4구간 끝에서 코끼리를 냉장고에 넣으면 보스에게로 가는 협동맵을 만든다.
보통 아슈가 하는 방법으로 코끼리가 날뛰는 서바이벌 맵을 놔둔 뒤 런너가 '열려있는 거대 냉장고' 아이템을 놔둔다.
하프 라이프?
고든 프리맨 대신 코끼리가 있는 MOD를 플레이한다.
플레이하다보면 냉동고 안에 들어가게 된다. 냉동고 = 냉장고
작은 코끼리를 만들어 냉장고에 넣는다.
팀 포트리스 2
코끼리에게 빨간(또는 파란) 칠을 한다.
코끼리에게 스파이의 기술을 가르쳐준다.
코끼리를 스카웃으로 변장시킨다.
만약 코끼리에게 스파이의 기술을 가르쳐줄 수 없으면 스카웃 가면을 씌운다.
키가 작아진 코끼리를 냉장고에 넣는다.
데스 프리지 함정 카드
필드 위에 '데스 엘리펀트'가 있을 때 발동할 수 있다. 데스 엘리펀트를 이 카드에 장착한다.

You just activated my trap card.jpg

멀티플레이를 한다.
서버 운영자에게 'tp elephant refrigerator'를 쳐달라고 한다.
마인크래프트 2
서버 운영자에게 'give refrigerator (코끼리의 아이템코드)'를 쳐달라고 한다.
코끼리의 아이템 코드는 알 게 뭐야.
마인크래프트 3
가구모드와 코끼리모드를 찾아 다운받고 설치한 뒤
냉장고를 조합후 그 안에 코끼리를 넣는다
마인크래프트 4
상자 텍스쳐를 냉장고로, 원하는 아이템 텍스쳐를 코끼리 모양으로 만든다.
냉장고 텍스쳐를 가진 상자에 코끼리 텍스쳐를 가진 아이템을 넣는다.
마인크래프트 5
모 크리쳐 모드를 다운받고 가구 강좌에나온 냉장고를 만들어서 디스펜서안에 코끼리 스폰에그를 넣는다.
아니면 냉장고처럼 생긴 냉장고를 만든뒤에 새끼코끼리를 넣으려고 노력한다. 하지만 성질이 뻗쳐서 그만둘수도 있는데 알게뭐야.
하얀섬을 켠다
지훈루트로 들어간다
비밀의 전화기 모드를 활성화 한다
타이밍 맞춰 전화를 걸어 개발자와 통화를 시도한다
코끼리를 만들어 달라고 한다
어드벤처 게임의 전통을 따르는 방식으로 비주얼샤워분들의 라면비를 쪼개가며 만든 코끼리를 인벤토리에 넣는다
왼쪽집에 들어간다
어드벤처 게임의 전통을 따르는 방식으로 코끼리를 냉장고에 넣는다
코끼리 밑에 블루포탈을 쏜다.
냉장고 안에 오렌지포탈을 쏜다.
포탈 - 2
코끼리와 냉장고 사이에 분리 그리드를 설치한다.
이제 코끼리는 분해되어 매우 작아져 냉장고 속으로 들어간다.
에스퍼의 요술장갑으로 코끼리를 작게 만든다
냉장고에 넣는다
롤러코스터 타이쿤 3
게임을 실행한후 공원이름을 냉장고로 바꾼다.
공원에 코끼리를 설치한다.
이제 코끼리는 냉장고 속에 있다.
롤러코스터 타이쿤 3 - 2
게임을 실행한후 "도구 - 사람 디자이너" 를 클릭한다.
사람 그룹이름이나 가족 구성원의 이름을 "코끼리" 로 설정한다.
위와 같은방법으로 공원의 이름을 냉장고로 바꾼다.
사람 디자이너에있는 가족그룹은 공원에 항상 등장하므로, 코끼리는 냉장고 안에 있다.
새 게임을 시작할때 시작할 행성의 이름을 "냉장고" 로 설정한다.
그리고 세포 또는 크리쳐에게 "코끼리" 로 이름을 짓는다.
문명 5
게임을 할때 나라를 인도로 선택한다.
도시를 건설한후 도시의 이름을 "냉장고" 로 설정한다.
그 도시에서 인도의 고유유닛 "전투코끼리" 유닛을 생성한다.
문명 5 - 2
XML수정을 이용하여 "코끼리" 라는 유닛을 새로 만들거나 어떤 유닛의 이름을 "코끼리" 로 바꾼다.
위와 마찬가지로 도시를 건설 후 도시의 이름을 "냉장고" 로 설정한다.
"코끼리" 라는 유닛을 뽑는다.
XML을 수정하는 것은 매우 백괴스럽게 어렵다 카더라. 그렇지만 알 게 뭐야.
@Hamumu에게 50달러를 바쳐서 코끼리 모자를 스폰서한다.
조합으로 냉장고를 만든다.
그리고 코끼리 모자를 쓰고 냉장고에 들어간 뒤 문을 닫는다.
PROFIT!!!] 그러나 백괴스럽게도 죽는다.
댄스 댄스 레볼루션
e-Amusement 카드를 산다.
베이직 코스에 가입한다.
닉네임을 FRIDGE로 정한다.
에디트 스텝 파일을 작성한다.
그 파일 이름을 elephant라고 한다.
RPG 만들기
코끼리 이벤트와 냉장고 이벤트를 작성한다.
코끼리가 냉장고 쪽으로 가도록 처리한다.
냉장고 이벤트를 이동처리하여 냉장고 문이 열리게 한다.
코끼리가 냉장고 이벤트로 이동한다.
코끼리 이벤트를 투명처리한다.
다시 냉장고 이벤트를 이동처리하여 냉장고 문을 닫히게 한다.

영화에서의 편법[원본 편집]

화려한 휴가
다스베이더를 부른다.
코끼리에게 말한다. I am your father
코끼리는 충격을 받고 냉장고에 들어간다.
코끼리의 뇌 신호를 나비족의 육체와 공유한다.
(잠깐만, 이제 어떻게 넣지?)
코끼리를 잡아먹은 뒤 냉장고로 트랜스폼한다.
헐크에게 코끼리를 먹인다.
이제 헐크의 화를 풀어주고 냉장고에 처넣는다.
새 슈트의 이름을 Mark-elephant라고한다.
토니 스타크는 프리져 스타크라 개명한다.
슈트를 입는다.
은밀하게 위대하게
코끼리가 이영화를 보게한다.
그리고 출구에 냉장고를 설치한다.
코끼리는 빠순이함성이 시끄러워 냉장고속으로 들어가게된다.
나홀로 집에
코끼리가 열차 밖으로 나간다.

밖이 꽁꽁 얼었으니 냉장고와 같다.

광복절 특사
해리 포터
(지팡이를 코끼리에 겨누고) 리듀시오!

인물별 편법[원본 편집]

[원본 편집]

코끼리가 냉장고에 들어갈 때까지 단식을 한다.
간디 2
코끼리가 들어가지 않더라도 비폭력과 무저항으로 버틴다.
간디 3
코끼리만 순순히 냉장고에 넣는다면 유혈사태는 일어나지 않을 것입니다.
코끼리를 냉장고 위에 올려놓는다.
그래도 코끼리는 냉장고에 있다고 말한다.
야훼지졌어에게 기도한다.
나 냉장고인데 거기 코끼리가 누구요
"네 소원이 무엇이냐?" 하고 하느님이 물으시면, 나는 서슴지 않고 "내 소원은 코끼리가 냉장고에 들어가는 것이오" 하고, 대답할 것이다.
피겨스케이트로 코끼리에게 무심한 듯 시크하게 하이킥을 날려 냉장고 안에 집어 넣는다.
하이킥을 날려서 코끼리를 냉장고로 집어넣는다.
고이즈미 준이치로
야스쿠니 신사 참배를 한다.
신통력으로 코끼리가 냉장고 안으로 들어간다.
고든 램지
코끼리 요리를 가져온다.
이 코끼리는 너무 안익어서 다시 냉장고 안으로 들어가겠다!
코끼리의 귀를 자른다.
코끼리의 귀가 냉장고에 들어갔다.
공돌이에게 코끼리를 냉장고에 넣으라고 시킨다.
코끼리가 냉장고에 들어간다.
"거짓말도 천 번 하면 진리가 된다"
따라서 "코끼리가 냉장고에 들어갔다"를 천번 말하면 코끼리가 냉장고에 들어간다.
코끼리와 냉장고를 준비한다.
더 이상의 자세한 설명은 생략한다.
國K-1 후보
저를 뽑아 주신다면 코끼리를 냉장고에 꼭 넣겠습니다.
코끼리로 대동단결!
햇볓정책으로 코끼리가 냉장고에 들어가게 하지만 코끼리는 먹이만 받아먹고 들어갈 생각을 않는다.
김대중 2
노벨평화상 상금으로 세계최대의 냉장고를 만든다.
코끼리하고 싸움을 걸다가 진다.
못 넣는다.
코끼리가 냉장고에 들어가지 않으면 고소한다.
모방범죄 예방을 위하여 더욱 정확한 코끼리를 냉장고에 넣는 법을 알려드리지 못하는 점 양해 바란다?
더 이상의 자세한 설명은 생략한다.
코끼리의 목을 비틀더라도 냉장고에 넣을 수 있다.
IMF 말고는 물어 볼 곳이 없다.
백두산 정기로 불어넣는다.
북한산 똥돼지
넣었다고 발표한다.
코끼리를 냉장고에 집어넣으려다가 대한민국과 미국에게 극딜당한다.
제 2의 코끼리가 되더라도 냉장고 안으로 들어가겠다.
여기있었구만 코끼리. 나 두한이야. 왜 왔는지 알겠나?
(냉장고에) 들어갈 코끼리는 들어간다.
빌 게이
코끼리를 냉장고에 집어넣는 일을 수치스럽게 생각하지 마라. 너희 할아버지는 그 일을 기회라고 생각하였다.

[원본 편집]

다친 코끼리를 치료해준다.
감명받은 코끼리가 냉장고 안으로 들어간다.
러시아를 공격할 때 코끼리를 데리고 간다.
나폴레옹 2
내 사전에 불가능이란 없다.
남고생어 사용자
삐– 어서 안 들어가? (의 줄임말이다. 윤희 황제가 남고생어를 배울 때 창조한 문법이다.)
이러면 코끼리가 알아서 들어간다.
象可象 非常象라고 도덕경에 적는다.
코끼리를 코끼리라 하면 그 코끼리가 아니다.
그 코끼리가 아닌 것을 냉장고에 집어넣는다.
척 노리스
코끼리를 강렬한 눈빛으로 위협해서 스스로 들어가게 만든다.
그래도 안들어가면 돌려차기로 처박는다.
(어차피 고래도 수억번 집어넣는 그에게 코끼리는 시시해서 시도도 안한다. 냉장고와 그 옆에 있는 코끼리조차 척 노리스의 진노에서 벗어날 수 없다!)
척 노리스 2
돌려차기로 코끼리를 위협한다.
코끼리는 스스로 냉장고에 들어간다.
척 노리스 3
사실: 척 노리스가 아프리카에 간 일이 있었다. 코끼리는 척 노리스를 피해 냉장고로 들어갔지만, 척 노리스는 코끼리를 보지 못한 것에 분개하여 냉장고에 돌려차기를 날렸다.
대국민담화를 통해 어떻게 코끼리를 냉장고에 넣냐고 성질을 낸다.
롬현 2
...(냉장고에)넣을 줄을 알아야지!
전두환한테 물어본다.
코끼리는 죽었다!!
니트로 박사
시간과 예산을 조금만 더 주신다면 코끼리를 냉장고에 꼭 넣겠습니다.
코끼리를 냉장고에 집어 넣었다고 정준하에게 사기를 친다.

[원본 편집]

(코끼리에게) 냉장고입니다. 들어가 주시죠?
캐스터보로우즈성운의 갈리프레이행성에서 온 904살인가 905살먹은 최후의 타임로드
타임로드의 과학으로 겉보다 안이 더 넓은 냉장고를 만든다.
코끼리를 냉장고 안으로 집어넣는다.
캐스터보로우즈성운의 갈리프레이행성에서 온 904살인가 905살먹은 최후의 타임로드 2
타디스를 고쳐서 냉장고의 모습으로 변하게한다.
코끼리를 타디스 안으로 집어넣는다.
덩샤오핑 (등소평)
검은 코끼리든 흰 코끼리든 냉장고에만 집어 넣으면 되는거 아닌가? (흑묘백묘론)
코끼리를 생각한다. 고로 나는 존재한다. 따라서 내가 냉장고에 들어간다.
조교나 대학원생에게 맡긴다. 그리고 시험기간까지 못넣으면 시험지에 교수님이 볼 편지를 쓴다.

[원본 편집]

ㄹㄹ ㄹㄹㄹ?
ㄹㄹ ㄹㄹㄹㄹㄹㄹㄹㄹㄹ! ㄹㄹㄹ ㄹㄹㄹㄹ ㄹㄹㄹㄹ ㄹㄹㄹㄹ ㄹㄹ ㄹㄹㄹㄹ ㄹㄹ.?
코끼리가 알아서 냉장고에 들어갈 때까지 존내 팬다.
밥 로스
코끼리를 냉장고에 이렇게 넣으면 됩니다. 참 쉽죠?
루이 14세
(코끼리 고기를 먹으며) 짐이 곧 냉장고다!
리차드 매드슨
코끼리는 전설이다.
코끼리의, 코끼리를 위한, 코끼리에 의한 냉장고를 만들겠습니다
러셀, 버트런드
화성목성 사이에 현대의 천문기술로 관측 불가능한 냉장고가 있고, 그 안에 코끼리가 들어있다는 것은 반증 불가능하고, 고대 서적에 적혀있고, 매주 일요일마다 진리로 가르쳐지며, 학교에서 어린이의 머릿속에 주입한다면 그것에 반대하는 것은 일탈의 징표일 것이다.

[원본 편집]

칼 마르크스
만국의 코끼리들이여! 냉장고 안으로 들어가라!
칼 마르크스 2
자본가가 코끼리를 냉장고에 넣으면 돈을 주게 한다.
자본가는 넣지 못한다.
이제 코끼리를 넣지 못하므로 생기는 잉여 가치의 돈을 냉장고에 넣는다.
수십만의 코끼리를 인해전술로 냉장고에 밀어넣는다. 그래도 안되면 "저 짐승은 나쁜 짐승"이라고 선언해 코끼리를 거의 멸종시킨다.
조작을 사용한다
막시민 리프크네
코끼리에게 '이 말라 비틀어진 뼈다귀 같은 자식아!'라고 한다.
이제 말라 비틀어진 뼈다귀를 냉장고에 넣는다.
가로 세로 높이 5m는 이 냉장고가 닿는 거리 / 지금부터 코끼리를 넣을 거니까 떨어져 있어 주세요
사이즈는 적절하게 조절하면 된다.
무 썰리니?
일단은 냉장고에서 파스타를 꺼낸다.
그 다음 히틀러에게 물어본다.
아기 코끼리를 인도에서 밀수입한다.
아기 코끼리가 냉장고 안으로 들어간다.
코끼리 넣은 걸로 해주세요. 제발~
풍혈로 코끼리를 빨아들인 후 자신이 냉장고에 들어간다.
코끼리가 냉장고에 들어가는 것은... 하늘의 뜻이 요만큼.
미츠루기 레이지
재판장을 협박해 냉장고에서 법정을 열게 만든다.
코끼리를 증인으로 소환한다고 하면 이토노코가 알아서 다 해먹는다.
광화문에서 표를 얻기 위해서라면 뭐든지 하기 때문에 코끼리를 냉장고에 집어넣는 퍼포먼스도 가능할 것이다. 알 게 뭐야.

[원본 편집]

코끼리를 냉장고에 넣을 때까지 참으라며 계엄령을 실시한다.
박통 2
코끼리가 냉장고에 들어가야만 한다는 내용을 담은 유신헌법을 통과시킨다. 코끼리가 이를 어길경우 긴급조치로 잡아들인다. 다음은…말 안해도 알 것이다.
검증의 쓰나미가 몰려와 코끼리를 냉장고에 넣는다.
박근혜 2
휴전선은 이상 없습니까?
박근혜 3
코끼리는 냉장고에 들어가야 하고 플러스 알파를 요구한다.
박근혜 4
이 문제에 시달려 멘붕이 올 지경.
박근혜 5
(코끼리가 냉장고에 들어가지 않자) 참 나쁜 코끼리다.
박근혜 6
제가 이공계 출신이니 뭔가 DNA가 다르지 않겠느냐...... 제가 과학인들의 열정이 솟아나도록 모든 것을 걸고 한번 해보겠습니다.
박근혜 7
말실수를 저질러 냉장고를 코끼리에 넣겠다고 한다. 이를 지적하면 "병 걸리셨어요? 지금 저랑 싸우자는 거예요?"하고 성질이 뻗친다.
박근혜 8
전 우주가 도와주어 코끼리를 냉장고에 넣도록 해줄 것입니다.
냉장고로 캐스팅한다.
도도하게 기다린다.
너무 도도해서 코끼리가 냉장고 안으로 들어갈 것이다.
코끼리에게 호통을 쳐서 들어가게 한다.
코끼리를 축구공으로 생각하고 냉장고 쪽으로 찬다.
원더걸스를 부른다.
박태환은 쎄기 때문에 수영을 하면서 코끼리를 밀 수 있다.
냉장고에 집어넣는 것도 가능할 것이다.
알 게 뭐야.
찰스 몽고메리 번즈
스미더스에게 코끼리를 넣으라고 한다.
실패한다면 를 풀어 코끼리를 냉장고에 넣는다.
웨일런 스미더스
찰스 몽고메리 번즈의 명령을 받들어 코끼리를 냉장고에 넣으려고 안간힘을 쓴다.
웨일런 스미더스는 개나 호머 심슨으로 대체된다.
최초의? 전화를 코끼리에게 한다.
"이봐, 코끼리 군. 내가 지금 냉장고 안에 있는데 이리로 좀 와 보게."
코끼리는 벨을 만나러 냉장고 안으로 들어간다.
빵쌍빵쌍 빵쌍꼬끼리 삐야뽀루또 빵쌍! (지구인들아! 코끼리 냉장고 들어간다!)
넣을 수 있습니다. 꼭 넣어야 합니다.
빌리 헤링턴
Ang? (당신은 빌리를 피하여 냉장고에 숨었다. 당신의 코끼리?가 냉장고에 들어갔다.)

[원본 편집]

코끼리의 뇌를 빼서 업그레이드 시킨다.
업그레이드된 사이버엘리펀트를 냉장고에 넣는다.
코끼리를 몬스터볼에 넣는다. 그 다음 몬스터볼을 냉장고에 넣는다.
하얀 코끼리를 그린다.
아빠에게 보여준다.
흰 코끼리가 아니냐고 묻는 아빠에게 '코끼리가 들어간 냉장고'라고 우긴다.
나가있어! 코끼리야!
소녀시대 1
코끼리를 냉장고에 넣어달라고 말해봐~
소녀시대 2
코 코끼리 좀 넣어 주세요~
소녀시대 팬들에 의해 실현되었다.
소녀시대 3
'코끼리를 넣어봐' 라는 신곡을 발표한다. 왜국 오덕의 기술력으로 대형 냉장고를 만든다는 소문이
대한민국 소녀시대 팬들의 귀에 들어간다. 소녀시대 팬들이 몰려가 코끼리를 대형 냉장고에 밀어넣는다.
냉장고에 맹수에 둘러싸인 새끼코끼리를 그려놓는다.
어미코끼리에게 냉장고를 보여 준다.
스미스 요원
코끼리를 감염시켜 자신으로 만든다.
자신이 냉장고로 들어간다.
그녀가 "코끼리는 냉장고에 들어갈 수 있다" 고 생각하면, 이 세계는 원래부터 아무런 과학적 설명 없이 코끼리가 냉장고에 들어갈 수 있다는 것이 당연하게 생각되는 세계가 구축된다. 왜냐하면 그건 "원래 그랬기" 때문이다.
루크 스카이워커
'포스를 사용해라, 루크.'
포스를 써서 넣는다.
코끼리에게 냉장고로 들어오라고 명령한다.
명령을 거부할 경우에는 반동분자로 숙청하거나 시베리아 강제수용소로 보내버린다.
스티븐 시걸
냉장고를 쏘고 꺾고 차고 던진 뒤에 코끼리를 꺾고 차고 던져서 처박는다.
스티브 잡스
현실 왜곡장을 펼처 코끼리가 냉장고에 들어갈 수 있도록 힘을 불어넣는다.
코끼리가 삼성빠일수도 있지만 알게 뭐야?
스티브 잡스 2
자신의 팀원들을 주 120시간 근무로 혹사시킨다.
하지만 팀원들은 잡스와 일한다는 사실에 고무되어 열심히 일한다.
어느 한계점에 도달하여 직원들이 불평하면 "너희들은 할 수 있어!!!"라는 말을 남기고 튄다.
이 말에 감동한 팀원들은 iElephant 라는 신형 모델을 개발한다.
직원 중 한사람의 꼬맹이가 iElephant 를 냉장고에 넣는다.
스티브 잡스 3
(코끼리에게) Stay Hungry, Stay Foolish, in the refrigerator.
소형코끼리를 투영하여 냉장고에 넣는다.
시유는 열린 문이므로 뭐든 넣을 수 있다.
문에 코끼리를 넣고 시유를 '냉장고'라고 한다.
나나야 시키
나이프를 던진다
나이프와 동일한 속도로 달려간다.
코끼리가 나이프를 피하려 함에 동시에 목을 꺾는다.
죽은 코끼리는 17등분해서 두고두고 넣는다.
도대체 왜?
자녀에게 딱 맞는지
확인하지 않습니까?
그래서 결론은
Push Push 베이베 오 푸시 베이베
이러다 보면 코끼리는 어느새 냉장고에 들어가 있다.
니들이 코끼리를 냉장고에 넣을 줄 알아?
형왔다. 이 개 같은 코끼리 새퀴야. 10초 안에 냉장고 안으로 들어가라. 8초 9초 그딴 거 없다. 10초 안에 안 들어가면 굴다리 밑에서 그냥 존내 맞는거다.
조선냉장고에 당도한 것을 환영하오 코끼리는 나의 훌륭한 냉장고에 들어간 깨우친 코끼리 세종이오
싸이가 "코끼리야, 냉장고 안에 들어가서 같이 사진 찍자"라고 하면 코끼리는 냉장고에 들어간다.
코끼리가 냉장고 안에서 간직한다.
어머니!! 어서 저 코끼리를 냉장고안에 넣어주세요!! 어서 넣어달란말입니다!!
하지만 김두한이 와서 실패
상하이 조
야, 이 빨갱이 새퀴야! 저 코끼리를 냉장고 안에 넣으려고 우리가 얼마나 고생했는줄 알아?
다시한번 지껄여 봐봐!!

[원본 편집]

아나이스 델 카릴
코끼리 냉장고에 넣어줘~ 이자크는 맷집도 좋잖아~ 응~?
아나이스 델 카릴 2
아나벨 코끼리 냉장고에 넣을 꺼란 말야! 들어가 이 멍청한 코끼리야!
아리스토텔레스가 '코끼리는 냉장고에 들어갈 수 있다' 라고 말한다.
코끼리는 냉장고 프리패스 2000년권을 획득했다
언제나 코끼리 냉장고 문을 닫고
냉장고를 등에지고 살아가는 코끼리
냉장고 문을 닫고
냉동실 문을 닫고
캄캄한 냉장고 속에 내 자신을 가두고
보온병을 코끼리라고 우긴다.
보온병을 냉장고에 집어넣는다.
마리 앙투아네트
냉장고가 없다고 뭘 그렇게 호들갑이지? 아이스박스에 넣으면 되는거 아닌가?
에어 장
냉장고가 망가지고~ 코끼리가 죽어버리고~ 부엌이 황폐화되고~ 이러한 현실속에서
버락 오바마
똑똑한 한국 어린이들을 부른다.
코끼리가 냉장고에 들어갈 방법을 생각하게 한다.
코끼리도 냉장고에 못 넣는 것들이 잘난 척하기는! 적어도 나 정도는 돼야지!
어.. 냉장고에 코끼리가 들어갈 수 있을지는 국민의 의견을 물어보고 어... 음...
안들어가면 통조림으로 만들어버리겠다고 협박한다.
코끼리에게 돈을 지불하고 들어가라고한다.
흥해 흥해 하면서 코끼리를 달랜다
이순재 2
묻지도 따지지도 않고 코끼리를 넣는다.
냉장고 안에 너 있다
코끼리여, 네 시작은 미약하였으나 그 끝은 냉장고이리라.
코끼리에게 운지천을 마시게 한 후 미치게한다.
냉장고 안에서 코끼리 카드를 소환한다

H2O가 뭔가요? - 코끼리. 문과 출신인 나도 알고있음
이제 코끼리 = H2O = DHMO를 냉장고에 넣는다.
"넣지마 발 넣지마! 성질이 뻗쳐서 정말. 넣지마."
문익촌 2
자신을 까는 코끼리를 찾아낸다.
냉장고에 들어가지 않으면 고소하겠다고 협박한다.
외계인 단원
코끼리의 용적을 계산하여 냉장고에 들어갈 수 있을 정도로 압축하여 넣는다.
코끼리는 555이고 냉장고는 664이다.
냉장고가 코끼리보다 109만큼 더 크다.
따라서 들어갈 수 있다.
코끼리를 냉장고에 넣기 위해 정권을 양보한다.
제가 미국 가서 '코끼리' 냉장고에 들어가라고 하니까 아무도 못알아들어요.
그래서 '쿼께이리' 이러니까 '아, 쿼께이리' 이러면서 들어가더라고요.
한반도 대냉장고 제작계획을 발표한다.
나도 왕년에 냉장고에 코끼리도 좀 넣어 보았다고 깝친다.
싱먼 리
일단 미국에 전화한다.
포기하고자 하면 못 넣을 것이요 넣고자 하면 들어갈 것이다 라고 말한다.
코끼리가 냉장고 안으로 들어간다.
이순신 2
코끼리의 생태를 면밀히 파악한 뒤 코끼리를 능히 다룰 수준의 사육사들을 모은다.
코끼리를 잘 유인한 뒤 학익진으로 포위하여 냉장고로 몰아넣는다.
그 냉장고에 코끼리로 넣고 남는 공간에 덤으로 기린도 좀 넣는다.

이 글을 보려면 오른쪽의 "펼치기"를 눌러 주세요.

4색 구분 정리 증명과 페르마 정리 증명 요약

4색 구분 정리 증명
[1] 한 점에 접하는 모든 지역들은 3색으로 충분히 구분된다. 
[증명] 한 점에 접하는 지역들 중에서 한 지역을 선택할 때, 이 선택된 지역에 접하는 주변의 모든 지역들은 2색으로 충분히 구분되기 때문이다.
[2] 한 지역에 접하는 모든 지역들은 3색으로 충분히 구분된다. 
[증명] 한 지역 내의 한 점과 주변 지역들의 경계선들이 한 지역의 경계선과 만나는 점들을 연결할 때, 이 지역들은 결국 한 점에 접하는 지역들과 마찬가지로서 3색으로 충분히 구분되기 때문이다. 
[3] 한 지역과 한 지역에 접하는 주변의 모든 지역들을 구분함에는 4색으로 충분하다. 여기에서, 한 지역은 모든 모양의 무수한 지역들을 포함할 수 있다.
[증명] 한 지역에 접하는 주변의 모든 지역들은 3색으로 충분히 구분되기 때문이다.

2 가지 방법의 페르마 정리 증명
X+B=Y+A=Z, A=Z-Y, B=Z-X
X=(AB)1/nG+A, Y=(AB)1/nG+B, Z=(AB)1/nG+A+B
n=1 일 때, G=0 이고, n=2 일 때, G=21/2>0 임. 
X=(2AB)1/2+A, Y=(2AB)1/2+B, Z=(2AB)1/2+A+B.
c2=A, 2d2=B 일 때, X=2cd+c2, Y=2cd+2d2, Z=2cd+c2+2d2.
c+d=r 일 때, X=r2-d2, Y=2rd, Z=r2+d2. 

페르마정리 증명 제1방법
Xn+Yn=Zn, (Xn/2)2+(Yn/2)2=(Zn/2)2
a=Zn/2-Yn/2, b=Zn/2-Xn/2
Xn/2=(2ab)1/2+a, Yn/2=(2ab)1/2+b, Zn/2=(2ab)1/2+a+b 
Xn={(2ab)1/2+a}2, Yn={(2ab)1/2+b}2, Zn={(2ab)1/2+a+b}2
홀수 n 에서 X, Y 와 Z 가 자연수이면, 위식 좌변들의 Xn, Yn과 Zn 은 자연수이지만,
우 변들의 {(2ab)1/2+a}2, {(2ab)1/2+b}2, {(2ab)1/2+a+b}2 들은 자연수가 될 수 없는 모순이  발생함으로 X, Y 와 Z 는 자연수가 될 수 없다. 그러나 짝수 n 에서는 위와 같은 모순이 발생하지 않는다. 한편, 짝수 n  에서는 모든 피타고라스 수가 거듭제곱이 될 수 없음으로 자연수 해를 가질 수가 없는 것이다.

페르마정리 증명 제2방법
위 식에서 A=B 일 때, G=[{2(n-2)/n+…+21/n+1}n{2A(n-2)}]1/n 을 구할 수가 있고, 
상기의 식들을 이용하여, 모든 자연수 A, B에서, 
(AB)1/nG 이 절대로 자연수가 될 수 없음이 간명하게 증명된다. 

[증명인: 이재율과 이유진] 

아 펠과 하켄의 4색 구분 증명은 1200시간 컴퓨터작업이 필요하고, 와일즈의 페르마 정리 증명은 200 쪽 방대한 분량으로서,  간명한 증명 문제가 여전히 남아 있고, 우리의 간명 완벽한 증명들을 부정하는 수학자는 국내외 3만여 명 중에 아무도 없다.

우 리의 증명은 2580년 된 피타고라스 수를 완벽하게 구하는 새 공식 발견과 동시에 370년간 난제인 페르마 정리를 2가지 방법으로  간명하게 증명 완결한 것이다. 영원의 자재로서 축복된 우리 인간세계는 광명 가득하고, 청정 싱그러운 기운으로 밝고 따사로움  넘치는 곳인데, 권위에 맹종하는 자들의 무도덕 물결은 우리 사회를 어둡고 불안하게 만들고 있다. 우리는 이 실상을 바로 보고  꿋꿋이 일어서서 힘찬 노력으로 우리의 모든 지혜와 용력을 모아 올바른 과학사회를 실현하여 번영의 굳건한 터전을 이룩할 것이다.  이는 우리 인간 본연의 영광을 구현하는 일이다. 

2007. 11. 15. 

이재율 이유진 조광호 이문엽 황시연 김덕준 송귀석 일동.


[출처] 4색 구분 정리 증명과 페르마 정리 증명 요약|작성자 이재율

이 안에 적혀있는걸 이글루스디시인사이드 수학 갤러리에 도배하라고 코끼리에게 시킨다.
왠지 코끼리는 냉장고 안으로 들어간다.
일곱 마리 눈먼 생쥐
냉장고에 기둥, 뱀, 창, 절벽, 부채, 밧줄, 그리고 눈먼 생쥐 7마리를 집어넣는다.
그 생쥐들은 그것들을 면밀히 검토한 뒤에 그것이 코끼리라는 결론을 내릴 것이다.
주민투표를 실시한다. 코끼리를 냉장고에 넣지 못하면 시장직을 사퇴하겠다고 강변한다.
이디스 워튼
코끼리를 냉장고에 넣을 수 있는 두 가지 방법이 있다. 코끼리가 되거나 또는 그것을 담는 냉장고가 되는 것이다.
진행을 한다.
코끼리가 지겨워서 냉장고에 들어간다.
소녀시대를 부른다.
코끼리에게 대리운전을 부르라고 한다. 코끼리가 차를 타면 냉장고로 돌진한다.
이수근 2
키가 작아서 안됨.
아베 신조
(후쿠시마산 코끼리를)넣어서 응원하자!는 캠페인을 펼친다. 하지만 국민들은 외면한다
나의 성공을 위해 코끼리는 냉장고에 들어갔다.[1]
어딜 들어가! 어딜 들어가냐고!
이정희 2
그 문제에 대해서는 나중에 답변드리겠습니다.
이정희 3
제가 여기 나온 이유는 오직 하나, 코끼리를 냉장고에 넣기 위해서입니다.
의사 양반
들어가라고! 이 변절자 코키리 새끼들이... 다 죽여버리겠어.
원더걸스 1
텔미춤을 추며 코끼리를 넣는다.
원더걸스 2
코 코끼리 좀 넣어 주세요~
곧 원더걸스 팬들에 의해 실현되었다.
원더걸스 3
미국에 진출하여 빌보드 본차트 78위에 든다. "천조국 오덕의 기술력으로 실현되었다"
원더걸스 4
18대 총선 CF를 찍는다. "높으신 분들의 지시로 실현되었다".

[원본 편집]

내가 꿈속에서 코끼리를 냉장고에 넣는 꿈을 꾸었는데, 코끼리가 나인지 내가 코끼리인지…
그렇다면 내가 냉장고 안에 들어가면 되겠군!
코끼리를 냉장고에 넣었다는 사실에 의문을 표시하는 사람은 삼청교육대로 보낸다.
전대갈 2
29만원으로 살 수 있는 가장 큰 냉장고를 산다.
코끼리가 절대로 냉장고에 들어갈 수 없다고 호언장담한다.
몇 년후에 다시 코끼리가 냉장고에 들어간다고 말한다.
코끼리를 넣지 못하면 나를 두 번 죽이는 일이라고...
조슈아 폰 아르님
코끼리의 유령에게 냉장고에 들어가라고 한다.
조형ㄱ..아니 킬러 조
일단 을 마신다.
코끼리를 자신의 차로 냉장고에 처박는다.
"아니 내가 맨 정신에서 그런것도 아니고 술 좀 해서 그런건데 죄가 되나?"
그리고 내 아버지는 말했지. "냉장고 안에 코끼리를 집어넣는게 뭐가 그렇게 심각해?"
헬로우 마이클? 게임하나 할까? (혹은 게임을 시작하지.)
지금까지 너란 녀석은 항상 코끼리를 냉장고에 넣을 수 있다고 허풍을 떨어서 사람들을 혼란스럽게 하였네.
사람들은 당신을 보고 잉여인간, 혹은 백수라고 부르고 있지...
이제 당신은 그 오명을 벗을 때가 되었네,
당신앞에 마취된 코끼리와 냉장고가 있다. 1분안에 넣지 못하면 코끼리가 깨어나서 당신을 잡아먹을꺼야.
너무 어려우니 힌트를 주지...
넌 왜 냉장고에 들어가야 하는지 모르겠지.
하지만 넌 들어가야만 해
데우스 엑스 마키나아아아아
영국에서 우리는 16세기에 냉장고에 코끼리에 넣은 적이 있다고 사기현금지원을 요청한다.[2]
정주영 2
코끼리 천마리를 몰고 북조선으로 가서 협상한다.
자신의 가치로 유혹한다
돈을 받기 위해 냉장고에 들어가라 한다
코끼리는 돈에 취해 들어간다.
코끼리를 번쩍 들어서 냉장고 안으로 옮긴다.
차력 코끼리를 차력 먹으로 흡수한 후 시전한 다음 냉장고에 처넣는다.
코끼리를 석회마법 쓴 다음 부순 뒤 냉장고에 처넣는다.
코끼리한테 청룡의 각써서 냉장고에 처넣는다.
진 회축써서 냉장고에 처넣는다.

[원본 편집]

코끼리를 냉장고에 넣기 위해 사임한다.
코끼리가 냉장고에 안들어가는 이유는 간 때문이야
네이버 지식인에 접속한다.
"코끼리를 냉장고에 집어넣는 법"을 묻는 질문을 찾았다.

내공냠냠, 출처:내머리

[원본 편집]

카가미네 린&렌
로드롤러로 코끼리를 으깬다.
곤죽이 된 코끼리를 잘 포장해 그 역겨운 것을 여러 개의 냉장고에 넣은후, 아이스크림으로 만든다.
바보에게 먹인다. 이제 코끼리는 냉장고에 들어가 있었지만, 이제는 사람속에 들어가 있다.
큭...큭큭큭... 코끼리 따위... 냉장고에나 들어가 버려... 으흐흐... 아하하하하... 쿡쿡쿡...
이즈미 코나타
코끼리의 머리와 엉덩이가 어디인지부터 찾는다.
모리 코고로 뒤에만 있으면 모든것이 해결된다.
코난 2
코끼리에게 아퍼톡신 4869를 먹인 후 냉장고에 넣는다.
냉장고를 깬 다음에 코끼리를 집어넣는다.
콜럼버스 2
파리를 냉장고에 넣는다
파리가 코끼리라고 끝까지 믿는다.
비토 콜레오네
코끼리에게 절대로 거절하지 못할 제안을 한다.
EUC-KR로 입력이 불가능한 인간
"코끼리는 냉장고에 들어갈 수 있다"고 생각하는 민폐단장에게 "그런 게 가능할 리 없잖아!"라고 일갈한다. 그러면 주위 단원들이 어찌어찌 해서 설득을 하고, 거기에 넘어가서 코끼리를 냉장고에 집어넣는 일에 동참하게 된다.
빌 클린턴
코끼리를 냉장고에 집어넣을 방법이 생각나지 않는다.
스캔들을 일으켜 국민들의 관심을 돌린다.
마틴 루터 킹
저에게는 꿈이 있습니다.
언젠가 이 나라가 모든 코끼리들은 냉장고에 들어간다는 것을
자명한 진실로 받아들이고
그 진정한 의미를 신조로 살아가게 되는 날이 오리라는 꿈입니다.
언젠가는 조지아의 붉은 언덕 위에 예전에 노예였던 코끼리들과
그 노예의 주인이었던 코끼리들이
형제애의 냉장고에 함께 들어가 앉는 날이 오리라는 꿈입니다.
너는 이미(냉장고에)들어가있다.

[원본 편집]

타라 덩컨
마법으로 코끼리를 축소시키거나 냉장고를 크게 만든다.
생각보다 쉽지는 않을 것이다. 타라가 마법을 잘 조절하지 못하면 코끼리가 미생물만하게 줄어들거나 냉장고가 아더월드?만하게 커질 수 있다.
타라 덩컨 2
크레디트-무트 금화?가 엄청나게 든 주머니를 주며 말한다.
"코끼리가 들어갈 만한 냉장고를 만들어주세요."
타라 덩컨은 아더월드에서도 최고의 판도를 자랑하는 제국의 여제이므로 따위야 뭐...
코끼리가 800만엔짜리 르네의 꽃병을 깨먹도록 한다.
800만엔을 내거나 냉장고에 들어가라고 한다. 코끼리는 틀림없이 냉장고에 들어간다.
못 넣는 게 아니라 안 넣는 거잖아요.
코끼리를 초특급진화 시킨 뒤 풀릴 때까지 기다린다.
풀려서 유년기로 돌아간 코끼리를 냉장고에 넣는다.
앨빈 토플러
제 2의 물결 사회에서는 이러한 문제를 해결할 수 없었다.
하지만 제 3의 물결 사회에서 코끼리는 냉장고에 들어갈 수 있을 것이다.
힘으로 쑤셔 넣는다.
가슴에 코끼리가 날아와 꽂힌다.
하지만 걱정하지마라
손은 눈보다 빠르니까
아귀한텐 밑에서 냉장
정마담도 밑에서 냉장
나 냉장
아귀한텐 다시 밑에서 냉장
이제 정마담에게 마지막 냉장

동작그만 밑장빼기냐?
내 패하고 정마담 코끼리를 밑에서 뺐지
너는 나한테 구땡을 줬을것이여
그리고 정마담한테 줄려는 이거 이거
이거 이거 장짜리 아니여?
시나리오 쓰고 있네 미친새끼가
손모가지 날아가붕게
이제 해머로 코끼리를 분해해서 넣는다.

[원본 편집]

코끼리의 영혼을 카드에 담는다. 카드를 냉장고에 넣는다.
코끼리는 냉장고에 들어갈 수 없을 것이다.
피터 슈라이어
코끼리들에게 눈치를 준다.
코끼리가 냉장고 안으로 들어가 있다.
T. 풀러
코끼리가 클 수록 냉장고는 좁다.
고든 프리맨
빠루가 있으면 모든 것이 해결된다.
벤자민 프랭클린
백권의 책에 쓰인 말보다 한 가지 성실한 마음이 더 크게 코끼리를 움직인다.
나는 코끼리를 냉장고에 넣는 방법을 알고 있지만, 여백이 부족하므로 생략한다. 라고 쓴다
여백이 부족하므로 성립한다. 실제로 될지는 알 게 뭐야

[원본 편집]

하츠네 미쿠
머리카락으로 채찍질해서 넣는다. 정 안 되면 자기의 마스코트인 파를 이용해 강제로 집어넣는다, 그리고 오리히메에게 우려먹지 말라고 협박한다.
하츠네 미쿠 2(악 시리즈)
리리안느에게 푸른 사람포기하는대신 해달라고 한다.
하츠네 미쿠 3(악 시리즈)
클라리스한테 안하면 널 버리겟다고 협박한다.
리듀시오라고 외친다. 그러면 코끼리가 작아져서 냉장고에 수월하게 넣을 수 있다.
본좌께서 코끼리에게 눈빛을 쏜다.
코끼리가 냉장고 안으로 들어간다.
허경영 2
(코끼리가 냉장고에 들어갈 수 있게) 내 이름을 불러봐.
허경영 3
코끼리를 공중부양시킨다. 냉장고 안으로 들여보낸다.
천연 코끼리와 합성 코끼리가 있습니다. 천연 코끼리는 냉장고에 들어가고, 합성 코끼리는 냉장고에 들어가지지 않습니다.
너희가 우리 군인 10명을 죽일 때 우리는 너희 편 1명을 죽일 테지만 결국 코끼리를 냉장고에 넣는 것은 우리들일 것이다.
녬쟣굥 뮨읠 연댜。 긍뎨 쿜끨의는 애 앙 드려갖읜흔 고야!!! 앙틔들 떄문헤 앙 드러가즤쟈나!!!!
코끼리를 냉장고에 넣으려다 임요환에게 벙커링을 당한다.
도조 히데키
코끼리에게 냉장고에 들어오라고 요구한다.
코끼리는 거부한다.
진주만을 폭격한다. (왜?)
코끼리에게 목욕을 한다고 속인다.
독가스를 살포하여 코끼리를 학살한다.
그 다음 코끼리를 냉장고 안에 넣어 위장시킨 뒤 매장시킨다.
미개한 민족인 코끼리는 냉장고에 넣어야합니다!

기타[원본 편집]

신경 쓰지 않는다. (i don't care)
코끼리의 모습을 표절한 그림을 냉장고에 집어넣는다.
G드래곤 2
왜국의 한 클럽에서 이름을 모르는 왜국 사람이 보여준 냉장고에 들어간 코끼리 한 마리를 보았는데,
생김새가 일반 코끼리와 달라 냉장고로 들어간 코끼리가 아니라는 의심이 들었지만 코끼리를 냉장고에 넣은 것은 사실입니다.
G드래곤 3
우연히 길을 가다 코끼릴 봤어
혹시나 했던 내 예감이 맞았어
내가 준 냉장고를 들고 한쪽엔 손잡이를 열고
그냥 여기까지만 말할게
G드래곤 4
(코끼리를)담배인줄 알고 (냉장고에) 넣었어요
작은 하마
누구라도 코끼리를 건들면 아주 좆되는거야.
작은 하마 2
코끼리에게 칼빵으로 코끼리를 조각낸 후, 그 조각을 넣는다.
누구라도 작은 하마 앞에 얼씬대면 아주 좆되는거야.
그냥 냉장고에 코끼리를 넣는다.
누는 모든 행동이 가능하므로 코끼리를 냉장고에 넣을 수 있다.

방송적인 편법[원본 편집]

게이티비씨[원본 편집]

냉장고를 부탁해
냉장고에게 부탁한다

게이비에스[원본 편집]

우리말 겨루기
냉장고라는 단계를 만든다
답이 코끼리인 문제를 출제한다
퀴즈 대한민국
우리말 겨루기와 같게 한다
냉장고라는 노래를 코끼리라는 별명을 가진 사람이 부른다.
냉장고라는 노래를 코끼리라는 별명을 가진 사람이 틀렸다.
고로 코끼리를 냉장고에 집어넣을 수 없다.
하지만 송해 교주가 신에게 빈다.
신이시여! 신이시여!
신이시여! 신이시여!
신이시여! 신이시여!
신이시여! 신이시여!
어쩌다가 성공한다.
KBS 뉴스 9
추적 60분
소비자 고발
대국민 토크쇼 안녕하세요
코끼리가 냉장고에 안 들어간다고 고민 사연을 보낸다.
고민이 해결되면 코끼리는 냉장고에 들어갈 것이다.
연예가 중계

마봉춘[원본 편집]

말 그대로 무한으로 도전을 하니 도전을 하다보면 집어넣을 수 있다.
마봉춘 뉴스데스크
뉴스에 코끼리를 냉장고에 집어넣었다고 보도한다.
앵커가 웃는다
앵커가 어디서 웃었는 진 알 게 뭐야.
신비한 TV 서프라이즈
코끼리를 냉장고에 집어넣을 수 있는데 안 집어넣는거라고 음모론을 생성한다.
찾아라! 맛있는 TV
코끼리고기를 찾는다
코끼리고기를 냉장고에 집어넣는다.
세상을 바꾸는 퀴즈이므로 코끼리를 냉장고에 집어넣는 것으로 바꾼다.
뭔 말인지 이해 안가? 열심히 공부해라!
코끼리를 냉장고에 집어넣는 드라마가 나온다.
스포일러 한다.
나는 가수다
무릎팍 도사

SBS[원본 편집]

SBS 8 뉴스
순간포착 세상에 이런일이
코끼리를 냉장고에 집어넣는 사람을 찾는다.
항상 똑같은 식으로 소개한다.
출발! 모닝와이드
정글의 법칙
정글엔 코끼리가 없다.
SBS 인기가요
TV 동물농장
그것이 알고 싶다

채팅[원본 편집]

<e********> 저기서 노무현은
<e********> 코끼리를 냉장고에 넣었지만 언론사에서는 못 넣었다고 발표한다
<e********> 라거나
<l***> 음..
<l***> 노무현이 대국민담화에서 "새끼코끼리는 넣었는데 어미코끼리는 못넣겠어염" 하니까
<l***> 사람들이 "때려죽일넘 그거하나도 못해" 하고 한다든지
<e********> 오 그게 더 말이 되는 듯
<r***-**> "그래도 새끼코끼리는 넣었습니다. 참 잘 하지 않았습니까?"
<r***-**> <조선일보> 또 막말.. 노무현 어디까지 가나
<l***> ㅋㅋㅋ
<r***-**> <중앙일보> 어미코끼리도 못 넣은 정권의 오만
<p******> <쿠키뉴스> 3년 전 그 새끼코끼리, 어떻게 되었나?
<l***> 이명박 공약 "대운하로 어미코끼리를 운송해서 냉장고에 넣겠습니다"
<l***> 이명박 공약 "어미코끼리는 영어몰입교육으로 훈련시키겠습니다"
<r***-**> 쿠키뉴스 아놔 ㅋㅋㅋㅋㅋㅋㅋㅋ
<l***> ㅋㅋㅋ
코끼리와 냉장고
--- ‘코끼리’ 님이 #IN THE FRIDGE 채널에 입장하셨습니다. ---
<냉장고> 야 넌 뭐야? 꺼져!
<코끼리> 넌 또 누구여? 아 어쨌든 내 친구들 여기로 초대할테니까 너 좀 꺼져줄래?
<냉장고> 지X 작작해라. 남에 방에 멋대로 들어와서 꺼지라는게 말이 되냐? 덩치만 더럽게 큰 새X가..
<코끼리> 알았으니까 나가라고 내 말이 우습냐? 엉?
<냉장고> 이게 냉장고 안에 들어왔으면 나갈 줄도 알아야지 매너가 없네.
<코끼리> 그래 나 매너없으니까 냉장고 안에 더 있을게. 알겄냐?
<냉장고> 아 꺼지라고.
--- ‘아비코끼리’ 님이 #IN THE FRIDGE 채널에 입장하셨습니다. ---
--- ‘형님코끼리’ 님이 #IN THE FRIDGE 채널에 입장하셨습니다. ---
--- ‘누나코끼리’ 님이 #IN THE FRIDGE 채널에 입장하셨습니다. ---
--- ‘막내코끼리’ 님이 #IN THE FRIDGE 채널에 입장하셨습니다. ---
--- ‘어미코끼리’ 님이 #IN THE FRIDGE 채널에 입장하셨습니다. ---
<냉장고> 에이 시X. 냉장고 안에 왜이리 코끼리가 자꾸 들어오는지 원... 말세야 말세...

나라별 편법[원본 편집]

코끼리가 냉장고에 들어갔다는 루머를 퍼트린다.
국민의 절반이 믿는다.
대한민국 2
일본을 공격한다.
뿌레땅 뿌르국
냉장고가 없잖아! 이 바보야.
코끼리를 냉장고에 집어넣지 않으면 벌금, 알 게 뭐야 Dollar를 내야한다고 발표한다.
어차피 대륙에서는 일어난다.
듕귁 - 2
인민들의 피와 땀 그리고 수로 집어넣는다.
듕귁 - 3
아래와 같은 방법으로 넣는다. (짝퉁이 아니라 듕귁에서 만든 방법이다.)
냉장도 묺을 욘다.
코끼히를 놓늧다.
앵잧고 뮨읗 닺늫다.
듕귁 - 4
짝퉁 코끼리를 만들어 냉장고에 넣는다.
와(和)의 정신으로 코끼리를 넣는다.
왜국 - 2
코끼리에게 냉장고에 들어가지 않으면 일본도로 할복을 하라고 명령한다.
왜국 - 3
고대에서는 코끼리를 냉장고에 넣은 적이 있다고 교과서를 고친다.
코끼리를 냉장고에 집어넣는 행위는 반민주적, 비윤리적이라고 핑계를 대고 도망간다.
코끼리가 들어갈 수 있는 냉장고라며 홍보하고 전세계에 판매한다.
러시아에서는 냉장고를 코끼리에 집어넣습니다!!
코끼리를 냉장고에 집어넣으라고 명령한다.
실패하면 아오지로 보낸다.
또 다른 사람에게 시킨다.
또 실패하면 아오지로 또 보낸다.
이후 무한 반복.
조선민주주의인민공화국 - 2
대포동 미사일을 이용해 코끼리를 콩가루로 만든다.
그 콩가루를 냉장고에 넣는다.
조선민주주의인민공화국 - 3
냉장고를 살 돈이 없어서 넣지 못한다.
조선민주주의인민공화국 - 4
코끼리를 불바다로 만들어 그 재를 냉장고에 넣는다.
냉장고가 뭔지 몰라서 넣지 못한다.
조지고 부시는 대통령
..코끼리들은 냉장고만 우리로 알아듣는 자이다./-김正일은 불과 대포의 언어만 알아듣는 자이다.
제3세계의 핵 보유국가에 코끼리를 냉장고에 집어넣으라고 성명서를 낸다.
거부하거나 실패할 경우 악의 축으로 몰아붙여 전쟁을 선포한다.
쌀나라 2
코끼리를 냉장고에 집어넣는 법 문서를 만든다.
백괴나라 - 2
알 게 뭐야
백괴나라 - 3
냉장고란 문서를 만들고 그곳에다 코끼리라는 단어를 넣는다.
옹박 비디오테이프를 냉장고에 넣는다.
코끼리를 냉장고에 집어넣는 조형물을 만든다.
프랑스 - 2
코끼리가 사는 섬을 식민지배 한 후
그 섬의 이름을 '냉장고'라 정한다.
코끼리를 뜨거운 사우나에 집어넣고 얼마간 찐다.
문열린 냉장고로 출구를 막아놓고 코끼리가 돌진하기를 기다린다.
코끼리가 냉장고에 집어넣는다면 그건 미국의 짓이라고 생각한다.
코끼리가 냉장고에 들어갈 수 있도록 기도를 드린다.
비폭력, 불복종 운동을 벌여서 넣는다.
코끼리를 넣어보려고 안간힘을 쓰다가
유럽쪽 구역에 문제를 떠맡긴다.
코끼리를 산 정상까지 올라오게 해서 지쳐 죽게 한 다음
달라이 라마에게 코끼리를 냉장고에 넣어달라고 싹싹 빈다.
코끼리를 자연산 냉장고에 넣어버리자는 생각으로
히말라야로 보내버린다.
코끼리를 미라로 만든 다음, 냉장고 관을 만들어
피라미드 안에 쳐 넣어버린다.
코끼리가 탄 배를 약탈하여 코끼리를 납치한 후
냉장고가 있는 배를 약탈하여 그 안에 코끼리를 넣는다
한국어 위키백과 제국
'코끼리를 냉장고에 집어넣는 법'이라는 문서를 만든 후
저명성이나 출처가 없으며 독자연구라는 삭제 정책을 거들먹거리며
재빨리 문서를 삭제한다.
한국어 위키백과 제국 2
'코끼리를 냉장고에 집어넣는 법'이라는 문서를 만든다.
왼쪽으로 치우쳤다!
조선일보로 지원사격한다.
수꼴들이 몰려와 수정한다.
국제 연합
코끼리가 냉장고에 안전하게 들어갈 수 있도록 안보리 결의안을 통과시킨다.
코끼리를 냉장고 에 넣어버린후 성지순례 시킨다.
이스라엘 - 2
쌀국에게 코끼리를 냉장고에
넣어달라고 빈다.
코끼리를 넣는 법을 모르므로
인도네시아에 코끼리를 보내버려서
알아서 냉장고에 들어가게 한다.
냉장고라는 이름의 인공섬을 조성하여 그 안에 코끼리를 방사한다.
코끼리한테 보리수 나뭇잎을 잔뜩 먹여 죽인 후
사리를 만들어 절의 냉장고에 넣는다.
코끼리한테 영어욕을 가르친 후 양키들 한테 말을 걸게 하여
잔뜩 맞게 하여 죽인 후, 냉장고에 시체를 묻는다.

지역별 편법[원본 편집]

한국어 위키낱말사전 왕국
‘코끼리’라는 단어를 찾은 후
‘냉장고’라는 단어를 찾아서
새로운 단어인 ‘코끼리를 냉장고에 집어넣기’을 만든다.
백괴나라에 존재하는
‘코끼리를 냉장고에 집어넣는 법 문서’를
그대로 베껴온다.
선진 한국의 문을 여는 사람들 뉴 라이트 전국 연합 왕국
{{{2}}}}‎ 가카에게 코끼리를
냉장고에 넣어달라고 앙탈과 떼를 쓴다.
조중동 연합
{{{2}}}}‎ 가카께서 코끼리를 냉장고에 넣었다고 보도한다.
그 다음날 정정 기사를 내보내며 사과하지만 이미 전국민에게 세뇌된 뒤였다.
고로 정정기사는 묻히며 영원히 코끼리는 냉장고에 들어간다.
'코끼리, 냉장고에 들어갔나?' 라는 추측성 기사를 한 번 찔러 본다.
코끼리가 자신들은 냉장고에 들어간 적 없다 항의하지만 적절한 의혹 제기였다며 합리화한다.
고로 의혹은 퍼지고 코끼리는 냉장고에 들어간 것이 된다.

그 외의 편법[원본 편집]

개드립을 친다.
주변이 얼어붙는다.
응 아니야
코끼리 : 응 지금 냉장고 안이야
빈곤한 코끼리
코끼리 : 아아아아 내 잔고!!내 장고!! 냉장고!!?
룬의 아이들 윈터러
보리스가 냉장고에 코끼리가 들어가길 소원한다.
윈터러는 무심한 듯 시크하게 보리스가 어떻게 되는지는 신경도 쓰지 않고 그 소원을 들어준다.
룬의 아이들 데모닉
조슈아를 시켜 코끼리 유령을 몸속으로 끌어들이라고 한다.
조슈아는 냉장고에 들어가 코끼리 유령을 내보내고 혼자 나온다.
코끼리의 길쭉한 코를 라고 한다.
'iFridge 를 출시한다.
'코끼리' 라는 기능을 집어 넣는다.
애플교도들이 열광한다.
뉴 라이트
코끼리를 냉장고에 집어넣으려다가 실패한다.
이게 다 노무현 때문이라고 우긴다.
중고나라 검색창에 '코끼리 냉장고'를 친다. 코끼리를 넣을만큼 큰 냉장고가 나올것이다.
산다. '코끼리'를 친다. 나오면 산다. 넣는다.
중고나라 스탭이 되어 '모든 냉장고에는 코끼리를 넣어 팔아야 합니다' 라는 규칙을 만든다.
로마에서는 로마법을 따라야 하기 때문에 코끼리가 들어가지 않은 냉장고를 올린 회원을 영구 재가입 불가 탈퇴 시킨다.
이 후 코끼리가 들어간 냉장고가 올라온다.
할인마트에서 ‘코끼리를 끼워파는 냉장고’를 구입한다.
‘코끼리’ 군과 ‘파리’ 양을 결혼 시킨다.
‘코끼리’ 부인을 냉장고에 넣는다.
Naver ignorance in.jpg 코끼리를 냉장고에 집어넣는 법좀 5가지 알려주셈 숙제임!’이라는 내용의 질문을 나베르에 올리고 스스로 답변한다.
코끼리는 냉장고에 들어갈 수 있다라고 방영한다. 빛나라 지식의 별! ★★★★★
스펀지 2
Q : 코끼리를 냉장고 속에 넣는 것이 가능합니까?
A : 네 그렇습니다.
코카콜라 CF
북극곰을 코끼리로 바꾼 뒤 코끼리가 냉장고 문을 열자마자 밀어 넣는다.
자사의 게임에서 시가 수백만 원짜리 게임 아이템을 내걸고 코끼리를 냉장고에 넣는 이벤트를 진행한다.
코끼리가 볼 때는 무관심한 척하다가, 코끼리가 안 볼 때 넣는다.
"흐..흐흥! 딱히 넣고 싶어서 넣은 게 아니라고! 그..그저 이 문서가 써져 있길래 참고해본 것뿐이야! 흥!"
군인정신 (특전사)
(코끼리가) 안 들어가면 들어가게 하라.
군인정신 (해병대)
누구나 다 코끼리를 냉장고에 넣을 수 있었다면 나는 코끼리를 냉장고에 넣지 않았을 것이다.
우유 속 진짜 코끼리 듬뿍’이라는 우유를 출시한다. 사서 냉장고에 넣는다.
‘코끼리는 원래 하얗다’라는 우유를 출시한다. 안 사도 편의점 냉장고에 있다.
구글 번역 1
아무거나 친다. 번역 제안을 누른다.
'코끼리는 냉장고 안에 들어갈수 있다.'라 쓴다. 제출한다.
구글 번역 2
'냉장고에 코끼리를 어떻게 집어넣습니까?'를 번역해서
'How did you put an elephant in the fridge?'란 결과를 번역해서
'어떻게 냉장고에 코끼리를 넣었어요?'란 결과를 번역해서
'How do you put an elephant in the fridge?'란 결과를 번역해서
'어떻게 냉장고에 코끼리를 배치해야합니까?'란 결과를 번역해서
'How do I put the elephant in the fridge?'란 결과를 얻는다
결국 구글 번역기도 어떻게 넣어야 할지 모른단다.
레고 블럭으로 코끼리를 만든다.
그 후 다시 부순 다음 냉장고에 넣으면 끝!
마법의 MD-5 시뮬레이터

[코끼리가 냉장고에 들어감] 공격:29 민첩성:77 방어:96 명중:87 운(運):41 HP:157

[코끼리가 냉장고에 들어가지 않음] 공격:28 민첩성:49 방어:65 명중:32 운(運):96 HP:236

코끼리가 냉장고에 들어감 vs 코끼리가 냉장고에 들어가지 않음전투개시!!

[코끼리가 냉장고에 들어감]의공격 HIT [코끼리가 냉장고에 들어가지 않음]는(은)1의 대미지를받았다。

[코끼리가 냉장고에 들어가지 않음]의공격 HIT [코끼리가 냉장고에 들어감]는(은)1의 대미지를받았다。

[코끼리가 냉장고에 들어감]의공격 HIT [코끼리가 냉장고에 들어가지 않음]는(은)46의 대미지를받았다。

[코끼리가 냉장고에 들어가지 않음]의공격 HIT [코끼리가 냉장고에 들어감]는(은)1의 대미지를받았다。

[코끼리가 냉장고에 들어감]의공격 HIT [코끼리가 냉장고에 들어가지 않음]는(은)54의 대미지를받았다。

[코끼리가 냉장고에 들어가지 않음]의공격 MISS [코끼리가 냉장고에 들어감]는(은) 공격을 피했다。

[코끼리가 냉장고에 들어감]의공격 HIT [코끼리가 냉장고에 들어가지 않음]는(은)1의 대미지를받았다。

[코끼리가 냉장고에 들어가지 않음]의공격 HIT [코끼리가 냉장고에 들어감]는(은)39의 대미지를받았다。

[코끼리가 냉장고에 들어감]의공격 HIT [코끼리가 냉장고에 들어가지 않음]는(은)1의 대미지를받았다。

[코끼리가 냉장고에 들어가지 않음]의공격 HIT [코끼리가 냉장고에 들어감]는(은)8의 대미지를받았다。

[코끼리가 냉장고에 들어감]의공격 HIT [코끼리가 냉장고에 들어가지 않음]는(은)30의 대미지를받았다。

[코끼리가 냉장고에 들어가지 않음]의공격 MISS [코끼리가 냉장고에 들어감]는(은) 공격을 피했다。

[코끼리가 냉장고에 들어감]의공격 HIT [코끼리가 냉장고에 들어가지 않음]는(은)1의 대미지를받았다。

[코끼리가 냉장고에 들어가지 않음]의공격 HIT [코끼리가 냉장고에 들어감]는(은)0의 대미지를받았다。

[코끼리가 냉장고에 들어감]의공격 HIT [코끼리가 냉장고에 들어가지 않음]는(은)37의 대미지를받았다。

[코끼리가 냉장고에 들어가지 않음]의공격 HIT [코끼리가 냉장고에 들어감]는(은)1의 대미지를받았다。

[코끼리가 냉장고에 들어감]의공격 HIT [코끼리가 냉장고에 들어가지 않음]는(은)1의 대미지를받았다。

[코끼리가 냉장고에 들어가지 않음]의공격 HIT [코끼리가 냉장고에 들어감]는(은)17의 대미지를받았다。

[코끼리가 냉장고에 들어감]의공격 HIT [코끼리가 냉장고에 들어가지 않음]는(은)1의 대미지를받았다。

[코끼리가 냉장고에 들어가지 않음]의공격 HIT [코끼리가 냉장고에 들어감]는(은)17의 대미지를받았다。

[코끼리가 냉장고에 들어감]의공격 HIT [코끼리가 냉장고에 들어가지 않음]는(은)1의 대미지를받았다。

[코끼리가 냉장고에 들어가지 않음]의공격 MISS [코끼리가 냉장고에 들어감]는(은) 공격을 피했다。

[코끼리가 냉장고에 들어감]의공격 HIT [코끼리가 냉장고에 들어가지 않음]는(은)80의 대미지를받았다。

[코끼리가 냉장고에 들어감]가[코끼리가 냉장고에 들어가지 않음]를(을) 쓰러트렸다。(라운드수:12)。

마법의MD5 - MD5배틀 http://www.newspace21.com/mix/btl_kr.php

저희가 생각해도 가능성이 아주 희박합니다.
저희가 생각해도 이상할 정도의 상황입니다.
그런데 그 코끼리가 실제로 냉장고에 들어갔습니다.
Will It Blend?

그 후 냉장고로 넣어준다!

Elephant가 이름에 들어간 모형 전차를 냉장고 속에 집어넣는다.
외계인 음모론
외계인에게 붙잡혔을 때 코끼리가 냉장고에 들어가 있는 것을 목격했다고 증언한다.
이 증언은 분명 진실이라고 주장하는 사람이 생겨난다.
코끼리에게 넌 냉장고에 들어가 있다면서 말이 틀리면 반박해 보라고 우긴다.
코끼리는 반박하지 않는다.
„거 봐! 반박 못하는 걸 보니 냉장고에 들어가 있다는 말이 맞잖어! ㄲㄲ”
양치기 소년
코끼리는 냉장고에 절대로 안 들어간다고 끊임없이 외친다.
결국 아무도 코끼리가 냉장고에 안 들어간다는 사실을 믿지 않게 된다.
무한 불가능 확률 추진
코끼리를 페튜니아 화분으로 변신시킨다.
그 화분을 냉장고에 넣는다.
코끼리를 냉장고에 집어넣는 3가지 방법
+ 코끼리를 냉장고에 집어넣는 7번째 방법
이 사진을 프린터로 인쇄한다.
인쇄한 용지를 냉장고에 넣는다.
QR 코드
Elephant QR Code.png
먼저 휴대폰 판매점에서 안드로이드폰이나 아이폰이나 옴니아폰을 구입한다.
휴대폰을 켠다.
휴대폰 앱스토어에서 QR 코드 촬영기를 구입한다.
위에 있는 QR 코드를 촬영한다.
코끼리 사진이 나왔으면 그 스마트폰을 냉장고에 넣는다.
채팅방 “냉장고” 를 만든 다음 사용자들의 이름을 모두 코끼리로 바꾼다.
코끼리보다 큰 냉장고를 만든다.
세계가 지켜보고 있습니다. 코끼리를 냉장고에 집어넣어주십시오.
코끼리를 코 끼리로 바꾼다. 그러고 코끼리든지 심영이든지 비둘기던지 빌리던지 코만 끼리끼리 모아 냉장고에 집어넣는다. 너무 잔인하면 붕어싸만'코' 갖다 하든지

알 수 있는 것[원본 편집]

코끼리를 냉장고에 집어넣는 법에 대한 풀이들에서 다음과 같은 것을 알 수 있다.

  • 코끼리는 초유체이다.
  • 코끼리는 수학을 잘 한다.
    • 또한, 코끼리는 C1 함수이다.
  • 코끼리는 상대론적, 양자론적 물체이다.
  • 믿으면 편하다.
  • 코끼리는 풍부한 감성을 지녔다.
  • 코끼리는 여름나기가 쉽다.
  • 코끼리는 끼리끼리논다.
  • 코끼리는 위대하다. 쳇!
  • 러시아에서는 코끼리에 냉장고를 넣는다.

뒷이야기[원본 편집]

어쨌든 이런 방법으로 코끼리를 집어넣는 데에 성공했다면, 당신은 다음 이야기에 귀를 기울여 볼 만하다.

코끼리를 냉장고에 넣는 방법은?(고전으로)

1.냉장고 문을 연다. 2.코끼리를 집어넣는다. 3.냉장고 문을 닫는다.

기린을 냉장고에 넣는 방법은?

1.냉장고 문을 연다. 2.코끼리를 뺀다. 3.기린을 집어넣는다. 4.냉장고 문을 닫는다.

3. 사자가 모든 동물을 생일 파티에 초대했다. 이때 갈 수 없는 동물은?

기린(냉장고 안에 있다)

4. 빨간모자가 강 건너에 있는 할머니 집에 가야한다. 그런데 그 강에는 식인 악어가 우글거린다. 어떻게 건너야 할까?

그냥 헤염쳐서 건넌다.(악어들은 모두 사자의 생일 파티에 갔다.)

5. 빨간모자가 할머니 집에 도착했다. 할머니와 식사를 하려고 할 때 무엇을 먹을까?

냉장고 안에 있는 기린 고기

진실[원본 편집]

이 문제는 마이크로소프트 입사 시험에 나온 문제라고 한다. 누군가의 말에 따르면 마이크로소프트의 도움말의 질이 그리 좋지 않은 이유는 이 때문이라고 한다.

도보시오[원본 편집]

주석[원본 편집]

  1. http://news.sportsseoul.com/read/baseball/485203.htm?ArticleV=old
  2. http://www.dalyong.com/2695617
Symbol star FA.svg 특집 기사
이 글은 특집 기사입니다. 좋아하는 글을 특집 기사로 만들고 싶으면 특집 기사 요청에 알려 주세요.
특집 버전: 2009년 3월 26일